Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found above coral outcrops or patch reefs of clear lagoons, channels, or outer reef slopes. Form large aggregations. Feed on zooplankton (Ref. 6113). A protogynous hermaphrodite (Ref. 55367). Males are territorial and haremic (Ref. 9710). Color patterns and size of sexual transition very slightly from one locality to the next. Total length for females from Ref. 9137.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and Natal, South Africa to Niue (Ref. 37816), north to Japan, south to Australia. Recorded from Europa Island (MNHN 1992-0508).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: Madagascar, Aldabra and western Mascarenes east to Society Islands, north to southern Japan, south to Western Australia, New Caledonia, Lord Howe Island and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 6 - 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 9710)); 7 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

In Belau this occurs in small groups a few meters off coral outcrops of steep dropoffs below 12 m. Elsewhere found above coral outcrops or patch reefs of clear lagoons, channels, or outer reef slopes at depths of 4 to 20 m. Feeds on zooplankton (Ref. 6113). Colour patterns and size of sexual transition very slightly from one locality to the next.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Color patterns vary from one locality to another.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 55 m (Ref. 26165), usually 5 - 35 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 54 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 2 - 79
  Temperature range (°C): 20.525 - 28.749
  Nitrate (umol/L): 0.027 - 2.751
  Salinity (PPS): 32.279 - 35.395
  Oxygen (ml/l): 4.130 - 5.079
  Phosphate (umol/l): 0.166 - 0.486
  Silicate (umol/l): 0.906 - 5.944

Graphical representation

Depth range (m): 2 - 79

Temperature range (°C): 20.525 - 28.749

Nitrate (umol/L): 0.027 - 2.751

Salinity (PPS): 32.279 - 35.395

Oxygen (ml/l): 4.130 - 5.079

Phosphate (umol/l): 0.166 - 0.486

Silicate (umol/l): 0.906 - 5.944
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 55m.
Recorded at 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found above coral outcrops or patch reefs of clear lagoons, channels, or outer reef slopes. Feeds on zooplankton.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner. A monandric species (Ref. 55367). Females are induced to change sex by removal of males from social groups (Ref. 38802). Sex-reversal is completed in 2-4 weeks after male removal in the area, or 170-280 days in an all female group (Ref. 34185, 34249, 34250). Length at sex change = 5.0 cm TL (Ref. 55367).Successful males spawn nightly with successive females (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudanthias squamipinnis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCTTGAGCCGGCATAGTAGGAACAGCCTTAAGCTTACTTATTCGAGCTGAACTAAGCCAACCCGGCGCGCTCTTAGGAGACGACCAGATTTATAATGTTATCGTTACAGCGCATGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGCTTTGGCAACTGACTAATTCCCCTAATAATCGGAGCCCCTGACATAGCATTCCCTCGAATAAATAATATGAGCTTTTGATTATTACCCCCTTCATTCCTTCTTCTCCTTGCTTCTTCAGGAGTAGAAGCAGGAGCGGGTACAGGATGAACAGTTTATCCCCCTTTAGCTGGTAACCTAGCCCACGCAGGGGCCTCGGTAGACCTCACTATCTTCTCCCTTCACTTAGCTGGTATTTCCTCAATTTTAGGGGCCATTAACTTTATTACCACAATTATTAATATAAAACCCCCAGCTATCTCCCAATACCAAACCCCATTGTTTGTATGAGCAGTACTTATTACAGCTGTCCTTTTACTACTGTCTCTCCCAGTTCTTGCCGCTGGCATTACAATACTTTTAACAGACCGAAACCTTAACACCACCTTCTTTGACCCCGCCGGCGGAGGAGACCCTATCCTTTACCAGCACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudanthias squamipinnis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 30
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sea goldie

The sea goldie (Pseudanthias squamipinnis), also known as the lyretail coralfish, lyretail anthias,[1] and scalefin anthias, is a small species of colourful fish in the subfamily Anthiinae. It is a common sight to scuba divers in the Indian Ocean.

Range[edit]

The sea goldie is found in the western Indian Ocean including the Red Sea, and in the Pacific Ocean as far east as Japan and southeast Australia. It is absent from the Persian Gulf and Oman.[1]

Description[edit]

Male sea goldie, Dahab

This species shows marked sexual dimorphism:[2]

  • Female: Length up to 7 cm, orange/gold colour with violet streak below the eye
  • Male: Length up to 15 cm, fuchsia colour with elongated third ray of the dorsal fin, a red patch on the pectoral fin, and elongated margins of the tail

The midas blenny, Ecsenius midas, goes through a phase of yellow colouration and is a social mimic of the sea goldie.[1]

The sea goldie feeds primarily on zooplankton.[2] Like other anthias, the sea goldie is a protogynous hermaphrodite; a male retains a harem of five to 10 females, but when the male dies, one of the females will undergo sex reversal and take the place of the missing male. Spawning occurs at sunset, between December and February (in the Red Sea).[3]

Habitat[edit]

The fish lives around coral outcrops in clear lagoons, patch reefs, and steep slopes to a depth of 35 m, often found in the company of Chromis diademata. They are often found in very large schools above the reef.[1]

References[edit]

  1. ^ a b c d Lieske, E. and Myers, R.F. (2004) Coral reef guide; Red Sea London, HarperCollins ISBN 0-00-715986-2
  2. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2007). "Pseudanthias squamipinnis" in FishBase. 5 2007 version.
  3. ^ Siliotti, A. (2002). Fishes of the Red Sea. Verona, Geodia ISBN 88-87177-42-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!