Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Relatively uncommon in mixed coral and rubble areas of lagoon and seaward reefs. The largest member of the genus (Ref. 1602). Feeds mainly on algae. Forms harems of 3-7 individuals. Frequently exported through the aquarium trade (Ref. 48391).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed in the Indo-Pacific region, being distributed from the northwestern Australian coast and Christmas Island (Australia) in the east, throughout Indo-Australian Archipelago to Vanuatu and Tonga in the west, and from southern Japan and the island of Taiwan in the north to Lord Howe Island (Australia) in the south (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006). It ranges from 4-35 m in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Christmas Island in the eastern Indian Ocean to Fiji, north to southern Japan, south to Scott Reef (eastern Indian Ocean) and Lord Howe Island. Uncommon around oceanic islands (Ref. 9710).
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14; Dorsal soft rays (total): 15 - 16; Analspines: 3; Analsoft rays: 16 - 17
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 190 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

19.0 cm TL (male/unsexed; (Ref. 9710)); max. reported age: 6 years (Ref. 11318)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
  • Moyer, J.T. 1986 Longevity of the anemonefish Amphiprion clarkii at Miyake-jima, Japan with notes on four other species. Copeia 1986(1):135-139. (Ref. 11318)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Overall black with an elongate vertical black blotch on the middle of the upper sides. When small, mainly black with a white bar; the white bar changes to a central blotch and varies greatly in shape and size (Ref. 48636). Dorsal and anal fins with submarginal blue line; most of the pelvic and the anterior portion of the anal fin yellow. Caudal fin with submarginal blue line (Ref. 1602). Body depth 1.8-2.0 in SL. Scales longitudinal series 45-48 (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Populations inhabit coral and rubble areas in lagoons and on seaward reefs (Pyle 2001, G.R. Allen pers. comm. 2006). Feeds on algae. It forms harems of three to seven individuals (Pyle 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 55m.
From 4 to 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 4 - 55 m (Ref. 30874)
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 45 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 0.915 - 44
  Temperature range (°C): 24.633 - 28.954
  Nitrate (umol/L): 0.047 - 2.632
  Salinity (PPS): 33.913 - 35.547
  Oxygen (ml/l): 4.421 - 4.851
  Phosphate (umol/l): 0.055 - 0.233
  Silicate (umol/l): 1.089 - 7.618

Graphical representation

Depth range (m): 0.915 - 44

Temperature range (°C): 24.633 - 28.954

Nitrate (umol/L): 0.047 - 2.632

Salinity (PPS): 33.913 - 35.547

Oxygen (ml/l): 4.421 - 4.851

Phosphate (umol/l): 0.055 - 0.233

Silicate (umol/l): 1.089 - 7.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Relatively uncommon in mixed coral and rubble areas of lagoon and seaward reefs. The largest member of the genus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Sex reversal is completed in 29-35 days (Ref. 34253).
  • Sadovy, Y. and D.Y. Shapiro 1987 Criteria for the diagnosis of hermaphroditism in fishes. Copeia 1987(1):136-156. (Ref. 34185)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropyge tibicen

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTACTATTTGGTGCTTGAGCTGGGATGGTAGGAACCGCTCTAAGCCTACTTATTCGAGCAGAACTAAATCAACCAGGCAGCCTCTTAGGCGACGACCAGATTTATAATGTAATCGTTACAGCACATGCATTTGTAATGATTTTCTTTATAGTTATACCAGCTATAATCGGAGGGTTCGGAAACTGACTGGTACCCCTAATAATTGGGGCTCCGGACATGGCATTCCCCCGAATGAACAACATGAGCTTTTGACTCCTCCCTCCCTCCCTTCTGCTTCTCCTCGCTTCTGCGGGGGTAGAGGCCGGGGCCGGAACTGGCTGGACAGTCTACCCCCCTCTAGCCGGCAATCTAGCCCATGCAGGAGCATCCGTAGACCTAACTATTTTTTCCCTTCACCTAGCAGGAGTCTCCTCAATTTTAGGAGCTATCAACTTTATTACTACCATTATTAACATGAAACCGCCAGCCATCTCTCAATATCAAACACCCCTATTCGTCTGAGCCGTGCTAATCACTGCTGTCCTTCTCCTCCTCTCCCTTCCAGTCCTTGCTGCAGGGATTACAATACTCCTTACAGACCGAAACCTGAACACCACCTTCTTTGACCCTGCAGGCGGAGGAGACCCTATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Centropyge tibicen

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R. & Myers, R.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, large overall population, collection for the aquarium fish trade is not globally impacting the population, and there are no other potential major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally common with stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Although it is often collected for the aquarium trade, harvest levels are not considered to be impacting the global population. There is no substantial habitat loss in the range of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place (G.R. Allen pers. comm. 2006). In view of the species large range it seems probable that populations are present within several protected areas (e.g., Lord Howe Island Marine Park).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Centropyge tibicen

Centropyge tibicen, known commonly as the Keyhole angelfish or Puller Angelfish, is a species of marine fish in the family Pomacanthidae.

The Keyhole angelfish is widespread throughout the tropical waters of the Indo-Pacific area.[2]

The Keyhole angelfish is a small size fish and can reach a maximum size of 19 cm length .[3]


References[edit source | edit]

  1. ^ Pyle, R. & Myers, R. 2010. Centropyge tibicen. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 September 2013.
  2. ^ http://eol.org/pages/204723/details#distribution
  3. ^ http://www.fishbase.org/summary/6548
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!