Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits lagoon and seaward reefs (Ref. 9710); found near coral (Ref. 5953). Feeds mainly on sponges and tunicates (Ref. 1602). Juveniles secretive and occur below 25 m (Ref. 37816). Adults in small but loose groups at moderate depths (Ref. 48636). Frequently exported through the aquarium trade (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is very widely distributed throughout the Indian Ocean and the tropical western Pacific Ocean (Pyle 2001). It has been recorded from Mozambique and Tanzania in the west, to Samoa in the east, and from southern Japan in the north of its range to New Caledonia and northern Australia in the south. It is found at depths of 10 to 80 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, Seychelles and Mascarenes east to Marshall Islands, Samoa and Tonga, north to southern Japan, south to Western Australia, Queensland (Australia), and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa south to 28°S (Ref. 33390) and east to Samoa, north to southern Japan, south to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14; Dorsal soft rays (total): 16 - 18; Analspines: 3; Analsoft rays: 17 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 250 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

26.0 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits coral or rocky reefs. Feeds mainly on sponges and tunicates (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body short and deep, and strongly compressed. Preorbital bone convex and without strong spines. Overall color is bright yellow with a broad black band on the edge of the anal fin and a broad white zone above it. A black spot is on the forehead and a ocellated dark spot just behind the head; the lips are blue. Juveniles have a false eye-spot at the base of the soft dorsal fin and a thin black line over the head, running through the eye (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits outer coral reef slopes and drop-offs at depths of 10 to 80 m, where it occurs as solitary animals in pairs, or in small loose groups (Pyle 2001). It is most likely encountered on outer reef drop-offs due to its preference for steep slopes (G.R. Allen pers. comm. 2006). Juveniles secretive and occur below 25 m (Myers 1991). This species feeds on sponges and tunicates (Pyle 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 40m.
From 3 to 40 meters.

Habitat: reef-associated. Threespot angelfish. (Lacepede, 1831)  Attains 25 cm. Completely yellow with black spot at base of D soft rays and vertical black band through the eye joined to black spot on nape. Widely distributed in Indo-West Pacific in 15-30 metres around coral; reaches Natal. Young less than 4 cm. with 7 to10 vertical irregular dark bands, a black ocellus at soft dorsal base, but without a black band along the lower margin of anal fin. Dark spot behind operculum, lips coloured blue.  Charles Savy is convinced that the black tip version is not a hybrid but the same species. He has dived the area for 29 years and cosistently monitoring a few sites where the black tip version A. armitage is always found. On one dive site he has done more than 100 dives and always found one particularly fish within 15 metres from a particularly spot. In 26 yearsof diving he has only seen A, xanthurus once and feels that this rare sighting should be discounted. He has seen colour variations where the dark colour has covered the entire fish to completely yellow with a black dot.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 3 - 60 m (Ref. 47838)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 60 specimens in 1 taxon.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): 3 - 100
  Temperature range (°C): 23.476 - 28.899
  Nitrate (umol/L): 0.146 - 4.152
  Salinity (PPS): 34.165 - 35.185
  Oxygen (ml/l): 3.927 - 4.701
  Phosphate (umol/l): 0.100 - 0.508
  Silicate (umol/l): 1.089 - 7.598

Graphical representation

Depth range (m): 3 - 100

Temperature range (°C): 23.476 - 28.899

Nitrate (umol/L): 0.146 - 4.152

Salinity (PPS): 34.165 - 35.185

Oxygen (ml/l): 3.927 - 4.701

Phosphate (umol/l): 0.100 - 0.508

Silicate (umol/l): 1.089 - 7.598
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occur inshore (Ref. 75154). Inhabit lagoon and seaward reefs (Ref. 9710); found near coral (Ref. 5953). Feed mainly on sponges and tunicates (Ref. 1602). Juveniles secretive and occur below 25 m (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apolemichthys trimaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Apolemichthys trimaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTATTATCTGGTGCTTGAGCTGGAATGGTAGGTACAGCTTTAAGCCTACTAATTCGAGCTGAACTAAATCAGCCAGGCAGCCTCCTTGGGGACGACCAAATCTACAATGTTATCGTCACAGCACATGCATTTGTAATAATTTTTTTTATAGTAATACCAGCTATAATTGGAGGATTTGGAAACTGACTAGTTCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATGAATAACATAAGCTTCTGACTCCTTCCGCCTTCCCTCCTACTCCTCCTAGCTTCTGCTGGAGTAGAAGCCGGGGCCGGAACCGGATGAACAGTATACCCCCCTCTAGCTGGCAACTTGGCCCATGCAGGCGCATCAGTAGACCTGACCATCTTCTCCCTTCATTTAGCGGGAGTTTCCTCAATTCTAGGGGCCATTATTTTTTTCACCACTATTATTAACATGAAACCCCCTGCTATCTCTCAGTATCAAACACCACTATTCGTCTGAGCAGTATTAATTACCGCAGTCCTACTACTTCTTTCCCTCCCAGTCCTTGCTGCAGGAATTACAATGCTCCTTACGGACCGAAACCTAAATACCACCTTCTTTGACCCTGCAGGAGGAGGAGACCCAATTCTTTACCAACACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, presumed large population and no apparent major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

It is generally common with stable populations.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collection is limited and is not considered to be impacting the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. It occurs in some marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!