Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A highly prized food fish usually caught by hand-lining over rock strata. Found in Hong Kong live fish markets (Ref. 27253).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Epinephelus fasciatomaculosus is a coastal species in the western Pacific from southern Japan to Taiwan, including mainland China, Philippines, Viet Nam, Hong Kong, Hainan and Sarawak (Heemstra and Randall 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northwest Pacific: southern China, Taiwan, East China Sea, Korea, and southern Japan (Kyushu to about 38°N on both coasts of Honshu). Reported specimen from Viet Nam may be Epinephelus fasciatomaculosus and records from the Philippines and India are unsubstantiated.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

58.0 cm TL (male/unsexed; (Ref. 89707)); max. published weight: 2,470 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Epinephelus fasciatomaculosus occurs in shallow rocky areas of bedrock and boulders at 15 to 20 m (Sadovy and Cornish 2000).

Feeding
Feeds on fishes, prawns, crabs, worms and gastropods (Chan 1968).

Reproduction
Minimum age at sex change two years (Chen et al. 1980b).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range ? - 55 m (Ref. 89707)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534). Widespread in rocky areas (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus akaara

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTCTTCTCGACTAATCACAAAGACATTGGTACCCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGAACTGCCCTC---AGCCTGCTCATTCGAGCTGAACTGAGCCAGCCTGGAGCCCTACTCGGCGAT---GATCAGATCTATAATGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGTGGCTTTGGAAACTGACTTATCCCGCTTATA---ATTGGCGCCCCAGATATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCCCCATCCTTCCTGCTTCTTCTAGCCTCTTCTGGGGTAGAAGCCGGCGCTGGTACTGGTTGAACAGTTTATCCCCCTCTAGCAGGAAACCTGGCCCATGCAGGTGCATCTGTAGACCTA---ACTATTTTCTCCCTACATCTTGCAGGGATTTCATCAATTCTAGGGGCAATTAACTTCATTACAACCATCATCAACATGAAACCTCCCGCCACCTCTCAGTATCAGACACCCTTGTTTGTATGGGCTGTCCTAATTACAGCGGTGCTACTGCTCCTGTCCCTCCCTGTTCTTGCCGCC---GGCATTACAATACTTCTAACAGATCGTAACCTCAACACTACTTTCTTTGACCCGGCCGGAGGGGGAGATCCTATCCTTTACCAACACCTGTTCTGATTCTTCGGTCACCCTGAAGTTTATATTCTAATTCTCCCTGGCTTCGGAATAATTTCCCATATCGTTGCATATTATTCTGGTAAAAAA---GAGCCATTCGGTTACATGGGTATGGTTTGAGCTATGATGGCCATCGGCCTTTTAGGGTTTATCGTATGAGCACATCACATGTTCACAGTCGGGATAGACGTAGACACACGTGCATATTTTACATCAGCCACCATAATTATTGCGATCCCTACTGGTGTTAAAGTCTTCAGCTGACTA---GCCACACTTCATGGGGGG---TCTATTAAATGAGAGACCCCACTTCTATGAGCACTCGGGTTCATTTTCCTCTTTACAGTAGGAGGGCTAACAGGGATTGTTCTAGCCAACTCTTCACTAGATATTGTTCTGCATGATACATATTATGTAGTTGCCCACTTCCACTACGTA---CTCTCAATAGGAGCCGTGTTTGCCATTGTAGCTGCCTTCGTGCACTGATTCCCTTTGTTTACAGGTTATACCCTACACAGCACTTGAACAAAAATCCACTTCGGAATCATGTTTGTGGGTGTAAATCTTACCTTCTTCCCTCAACATTTCTTAGGACTAGCTGGAATGCCTCGT---CGATACTCAGACTACCCAGATGCTTACACC---CTATGAAACACCGTATCTTCTATTGGCTCCATAGTTTCTCTTGTGGCAGTAATTATGTTCCTGTTCATTATCTGGGAAGCATTTGCCTCTAAACGTGAAGTT---CTAGCAGTAGAACTAACCATAACCAAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus akaara

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Epinephelus fasciatomaculosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTGTATTTGGTGCCTGAGCTGGAATAGTAGGAACCGCCCTCAGCCTGCTTATTCGAGCTGAACTGAGCCAGCCTGGAGCTCTACTCGGCGATGATCAGATCTATAATGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGTGGCTTCGGAAACTGACTTATCCCGCTTATAATTGGCGCCCCTGATATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCTCCATCCTTCCTGCTCCTTCTGGCCTCTTCTGGGGTAGAAGCCGGTGCTGGTACTGGCTGAACAGTCTACCCACCTCTAGCAGGAAACCTAGCCCATGCAGGCGCATCTGTAGACCTAACCATTTTCTCCCTACATCTAGCAGGGATTTCATCAATTCTAGGAGCAATTAACTTCATTACAACCATCATCAATATAAAACCCCCCGCTACCTCTCAATATCAAACACCTTTGTTTGTATGGGCTGTCCTAATTACAGCGGTGCTACTGCTTCTATCCCTTCCTGTTCTTGCCGCCGGCATTACAATACTTCTAACAGATCGTAACCTTAACACTACTTTCTTTGACCCAGCCGGAGGGGGAGATCCTATCCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus fasciatomaculosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Samoilys, M.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Epinephelus fasciatomaculosus is listed as Data Deficient. Although data are scarce, this small grouper is locally targeted in fisheries in Hong Kong and Taiwan and may also be subjected to habitat degradation from coastal development in Philippines and China due to its shallow habitats. In addition its range is limited. Conservation action including protected areas for this species is minimal in much of its range. This combination of factors suggest listing as Data Deficient because of no population data but potentially Near Threatened and, therefore, catches and effort should be carefully monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Epinephelus fasciatomaculosus was one of the most common nearshore fishes in the 1960s in Hong Kong waters, now only moderately abundant in local markets (Sadovy and Cornish 2000).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Although Epinephelus fasciatomaculosus is a small species, it is important in trawl, gill net and hook and line fisheries in Hong Kong and Taiwan because it is a favoured and valuable food fish (Heemstra and Randall 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endangered (EN) (A2d), IUCN Grouper and Wrasse Specialist Group
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Epinephelus fasciatomaculosus is probably found in some marine protected areas within its range (e.g., Philippines and Hong Kong).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquaculture: commercial; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!