Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Perhaps the most common grouper on Indo-Pacific coral reefs found below 40 m. The species is only known from insular localities except those collected from Pinda, Mozambique. Apparently, nothing is known of the biology of this species. The small size (
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

General
Cephalopholis spiloparaea is a widespread Indo-Pacific species ranging from East Africa (Pinda, Mozambique: 15°S) to French Polynesia and the Pitcairn Group, north to the Ryukyu Islands (Japan), and south to Heron Island at the southern end of the Great Barrier Reef (Australia).

Specific
American Samoa, Australia (Queensland and Western Australia, including Rowley Shoals), Christmas Island, Cocos (Keeling) Islands, Cook Islands, French Polynesia (Society Islands, Tuamotu Islands), Guam, India (Lakshadweep), Indonesia (Bali, Java, Lesser Sunda Islands, Moluccas, Papua, Sulawesi), Japan (Ogasawara-shoto, Ryukyu Islands), Kiribati, Maldives, Marshall Islands, Mauritius, Micronesia, Mozambique, New Caledonia, Palau, Papua New Guinea (Bismarck Archipelago, North Solomons), Philippines, Pitcairn, Réunion, Seychelles, Solomon Islands, Taiwan, Tanzania, Tonga, United States Minor Outlying Islands (Wake Island).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Pinda, Mozambique (15°S) to French Polynesia and the Pitcairn Group, north to the Ryukyu Islands, south to Heron Island at the southern end of the Great Barrier Reef. Often misidentified as Cephalopholis aurantia (or as Cephalopholis analis, a junior synonym of Cephalopholis aurantia).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Comores and western Mascarenes east to Pitcairn Group, north to Taiwan, Ogasawara and Wake islands, south to Western Australia, New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 14 - 16; Analspines: 3; Analsoft rays: 9 - 10
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 220 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Perhaps the most common grouper on Indo-Pacific coral reefs found below 40 m. Apparently, nothing is known of the biology of this species. The species is only known from insular localities except those collected from Pinda, Mozambique.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Cephalopholis spiloparaea is a reef-associated species found at depths from 16 to 108 m. It is perhaps the most common grouper on Indo-Pacific coral reefs found below 40 m. The species is known primarily from insular localities except those collected from Pinda, Mozambique. Little is known of the biology of this species other than spawning, courtship and feeding.

Reproduction
Donaldson (1995a) described courtship and spawning behaviour of Cephalopholis spiloparaea from Rota, Mariana Islands. This species has male-dominated haremic groups. Daily courtship behaviour began late in the afternoon and proceeded until after sunset. Males repeatedly visited females in single-male, multiple-female mating groups during each period and engaged in courtship bouts. Males were predicted to devote more effort toward intra-and interspecific interactions compared to females and to maximize reproductive success. Females were predicted to devote more effort towards foraging, compared to males. This behaviour maximizes reproductive effort. Foraging behaviour by both sexes was virtually absent during daylight and pre-courtship periods. Fish sought shelter and were not incidentally observed foraging after dusk, suggesting that this species actively forages later at night or during early morning hours, just prior to and during sunrise.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 15 - 108 m (Ref. 9710), usually 30 - 108 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 0.915 - 52
  Temperature range (°C): 25.634 - 28.988
  Nitrate (umol/L): 0.094 - 1.251
  Salinity (PPS): 33.803 - 35.550
  Oxygen (ml/l): 4.413 - 4.823
  Phosphate (umol/l): 0.088 - 0.214
  Silicate (umol/l): 1.094 - 4.407

Graphical representation

Depth range (m): 0.915 - 52

Temperature range (°C): 25.634 - 28.988

Nitrate (umol/L): 0.094 - 1.251

Salinity (PPS): 33.803 - 35.550

Oxygen (ml/l): 4.413 - 4.823

Phosphate (umol/l): 0.088 - 0.214

Silicate (umol/l): 1.094 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 15 - 108m.
From 15 to 108 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found inshore (Ref. 75154). Perhaps the most common grouper on Indo-Pacific coral reefs found below 40 m. The species is only known from insular localities except those collected from Pinda, Mozambique. Known from depths of 10-108 m. The small size (
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cephalopholis spiloparaea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cephalopholis spiloparaea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGAACAGCCCTTAGCCTGTTAATCCGGGCTGAACTAAGCCAACCAGGTGCTCTACTCGGCGATGATCAAATCTACAATGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTCGGAAACTGACTTATTCCACTAATGATCGGTGCCCCCGACATAGCATTCCCCCGAATGAATAATATGAGCTTCTGGCTCCTCCCCCCATCCTTCCTACTTCTGCTAGCCTCCTCTGGGGTAGAAGCTGGTGCTGGTACTGGTTGAACGGTGTACCCACCCTTAGCCGGTAACCTAGCCCACGCAGGTGCCTCTGTTGATTTAACCATCTTTTCTCTACATTTAGCAGGGATCTCATCAATTCTAGGAGCAATCAACTTTATTACTACCATTATTAACATAAAACCACCCGCCATCTCCCAATACCAAACACCCCTATTCGTTTGAGCCGTGCTAATCACAGCCGTTCTGCTTCTTCTCTCCCTTCCTGTCCTTGCTGCCGGCATTACAATGCTCCTAACAGACCGAAACCTTAATACCACCTTCTTCGATCCTGCCGGTGGGGGAGATCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Ferreira, B.P., Gaspar, A.L.B. & Myers, R.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Cephalopholis spiloparaea is probably one of the most widespread and common deepwater grouper species with no known major threats and, therefore, assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
General
Cephalopholis spiloparaea is not commonly seen in shallow waters, but in deeper outer reef slope areas waters it is probably more common.

Fishery-independent
Only one individual, measuring 30 cm, was recorded in New Caledonia, during underwater visual census in New Caledonia, French Polynesia, Fiji and Tonga in Barrier, Fringing, Intermediate, outer-barrier-reef and Lagoon-bottom reefs. Density estimates for the species were three individuals/per sq km, with a size was between 25 and 30 cm.

It is relatively common on reefs of the southern Mariana Islands (Myers 1999, in Donaldson, 2002).

In December 1995, Machida et al. (1997) reported seven species of groupers collected at Agdao Fish Market in Davao City, including C. spiloparaea, which was the first record from Mindanao for this species.

Fishery-independent data
Fishery statistics from The Sea Around Us From 1985 to 2002, C. spiloparaea represented 0.25% (304 kg) of total offshore catch of Serranidae (118,579 kg) in Guam.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to Cephalopholis spiloparaea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Cephalopholis spiloparaea occurs in marine protected areas throughout parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cephalopholis spiloparaea

Cephalopholis spiloparaea, known commonly as the Strawberry Hind or Orange-red Pigmy Grouper, is a species of marine fish in the family Serranidae.

The Strawberry Hind is widespread throughout the tropical waters of the Indo-Pacific area, Red Sea excluded.[2]

The Orange-red Pigmy Grouper is a medium size fish and can reach a maximum size of 30 cm length.[3]

References[edit]

  1. ^ Ferreira, B.P., Gaspar, A.L.B. & Myers, R. 2008. Cephalopholis spiloparaea. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 September 2013.
  2. ^ http://eol.org/pages/204631/details#distribution
  3. ^ http://www.fishbase.org/summary/6455
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!