Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in coral-rich areas of lagoon pinnacles, channels, and outer reef slopes. Solitary (Ref. 37816), a secretive species, usually hiding in caves and crevices in the reefs. One of the smallest species of groupers known. Omnivorous with diet composed of fishes and crustaceans; relatively low egg production per individual (Ref. 089707).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa (but not the Red Sea, Persian Gulf or South Africa) to the Society Islands, north to the Ryukyu Islands, south to northern Australia. Including most islands of the Indian Ocean and that of the west-central Pacific (Ref. 5222). Record from Rodriguez by Heemstra & Randall (1984, Ref. 3153) could not be verified and is probably erroneous (Ref. 33390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Northern Marianas, Line and Marquesas islands, north to Ryukyu Islands, south to Western Australia, Queensland (Australia) at 15°50'S, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 240 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

24.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Resembles C. urodeta, but always has a distinctive dark saddle on caudal peduncle (Ref. 37816); characterized further by reddish brown head with numerous red-orange or pinkish red spots, extending to pectoral region; mottled pinkish brown body; upper caudal-fin base with large dark brown saddle with smaller saddle just behind; upper part of caudal fin with dark brown streak, less intense streak on lower part; ctenoid scales on body including abdomen; greatest depth of body 2.6-2.9 in SL; rounded caudal fin; pelvic fins, 2.0-2.3 in head length (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs in coral-rich areas of lagoon pinnacles, channels, and outer reef slopes. A secretive species, usually hiding in caves and crevices in the reefs. One of the smallest species of groupers known. Gut analysis revealed crustacean remains.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Resembles C. urodeta, but always has a distinctive dark saddle on caudal peduncle (Ref. 37816); characterized further by reddish brown head with numerous red-orange or pinkish red spots, extending to pectoral region; mottled pinkish brown body; upper caudal-fin base with large dark brown saddle with smaller saddle just behind; upper part of caudal fin with dark brown streak, less intense streak on lower part; ctenoid scales on body including abdomen; greatest depth of body 2.6-2.9 in SL; rounded caudal fin; pelvic fins, 2.0-2.3 in head length (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 107 specimens in 1 taxon.
Water temperature and chemistry ranges based on 87 samples.

Environmental ranges
  Depth range (m): 0.5 - 75.905
  Temperature range (°C): 22.841 - 29.336
  Nitrate (umol/L): 0.019 - 5.586
  Salinity (PPS): 32.185 - 35.248
  Oxygen (ml/l): 4.057 - 4.718
  Phosphate (umol/l): 0.055 - 0.494
  Silicate (umol/l): 0.897 - 9.181

Graphical representation

Depth range (m): 0.5 - 75.905

Temperature range (°C): 22.841 - 29.336

Nitrate (umol/L): 0.019 - 5.586

Salinity (PPS): 32.185 - 35.248

Oxygen (ml/l): 4.057 - 4.718

Phosphate (umol/l): 0.055 - 0.494

Silicate (umol/l): 0.897 - 9.181
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 40 m (Ref. 9710), usually 3 - 20 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 107 specimens in 1 taxon.
Water temperature and chemistry ranges based on 87 samples.

Environmental ranges
  Depth range (m): 0.5 - 75.905
  Temperature range (°C): 22.841 - 29.336
  Nitrate (umol/L): 0.019 - 5.586
  Salinity (PPS): 32.185 - 35.248
  Oxygen (ml/l): 4.057 - 4.718
  Phosphate (umol/l): 0.055 - 0.494
  Silicate (umol/l): 0.897 - 9.181

Graphical representation

Depth range (m): 0.5 - 75.905

Temperature range (°C): 22.841 - 29.336

Nitrate (umol/L): 0.019 - 5.586

Salinity (PPS): 32.185 - 35.248

Oxygen (ml/l): 4.057 - 4.718

Phosphate (umol/l): 0.055 - 0.494

Silicate (umol/l): 0.897 - 9.181
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 40m.
From 1 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in the coral reefs of the Indo-West Pacific Region (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalopholis leopardus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGAACAGCCCTCAGCCTACTAATCCGGGCTGAACTAAGCCAACCAGGTGCTTTACTCGGCGATGATCAAATCTATAATGTGATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGTGGATTCGGAAACTGACTTATTCCACTAATAATTGGTGCCCCGGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGGCTTCTCCCCCCATCCTTCCTACTTCTGCTAGCCTCCTCTGGAGTAGAAGCTGGTGCTGGTACTGGTTGAACGGTGTATCCACCCTTAGCCGGTAACCTAGCCCACGCAGGTGCCTCTGTTGATCTAACCATCTTTTCTCTACATTTAGCAGGGATCTCATCAATTCTAGGAGCTATCAACTTCATTACTACCATTATTAACATAAAACCCCCTGCCATCTCCCAATACCAAACACCCTTATTTGTTTGAGCTGTATTAATTACAGCCGTTCTTCTCCTTCTCTCCCTTCCTGTCCTTGCTGCCGGTATTACAATGCTTTTAACAGACCGAAATCTTAATACTACCTTCTTCGACCCTGCCGGTGGGGGAGACCCGATCCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalopholis leopardus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cephalopholis leopardus

Cephalopholis leopardus, also known as the Leopard grouper or Leopard hind , is a demersal Marine fish belonging to the family Serranidae.

Description[edit]

The Leopard grouper is a small medium sized fish which grows up to 24 cm.[2] The body is fusiform or spindle-shaped and compressed laterally. The caudal fin is rounded. The mouth is big and has a superior position. The body background coloration is light brown, reddish or light green-gray. On the top part of the body, blotches form marbling like pattern. The low part is spotted. The front snout is covered with small red or dark dots . The leopard grouper can easily be confused with Cephalopholis urodeta but it differs mainly from this latter by two dark blotches located on the top part of its caudal peduncle. The caudal fin is distinguished by two red to dark lines forming a "V" and another black line parallel to the top line of the "V".[3]

Distribution & habitat[edit]

It is widely distributed throughout the tropical waters of the Indian Ocean, Red Sea, Persian Gulf and South Africa excluded, to the central island of the Pacific Ocean.[4]

Like many of the groupers, Cephalopholis leopardus lives in rich clear waters close to coral or rocky reefs from the surface until 40 metres (130 ft) depth with an average depth range from 3 to 20 metres (66 ft).[5]

Feeding[edit]

Cephalopholis leopardus is carnivorous and its diet consists mainly in small fishes and crustaceans, it's an ambush predator.

Behavior[edit]

The leopard grouper is solitary, territorial, demersal and has an nocturnal and/or a diurnal activity which can be maximal at sunrise and/or at sunset.[6] It is protogynous hermaphrodite, which means the female can evolved to male during its life.

References[edit]

  1. ^ Cabanban, A.S., Heemstra, P.C., Samoilys, M. & Kulbicki, M. (2008). "Cephalopholis leopardus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2013-06-18. 
  2. ^ http://eol.org/pages/204625/details#size
  3. ^ Lieske & Myers,Coral reef fishes,Princeton University Press, 2009, ISBN 9780691089959
  4. ^ http://www.fishbase.org/summary/6448
  5. ^ http://eol.org/pages/204625/details#habitat
  6. ^ Brulé & Déniel, ‘’ Expose synoptique des données biologiques sur le mérou rouge Epinephelus morio (valenciennes, 1828) du Golfe du Mexique’’, F.A.O., 1994,ISBN 9252034633
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!