Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in coral-rich areas of lagoon pinnacles, channels, and outer reef slopes. Solitary (Ref. 37816), a secretive species, usually hiding in caves and crevices in the reefs. One of the smallest species of groupers known. Omnivorous with diet composed of fishes and crustaceans; relatively low egg production per individual (Ref. 089707).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Cephalopholis leopardus is distributed in the Indo-Pacific, ranging from East Africa (but not the Red Sea, Persian Gulf, or South Africa) to the Society Islands (French Polynesia), north to the Ryukyu Islands (Japan), and south to northern Australia. Its range includes most islands of the Indian Ocean and those of the west-central Pacific (Heemstra and Randall 1993). It is also reported from Réunion (Leternour 1996), and is found in the east Andaman Sea (Allen and Stone 2005).

One record from Rodríguez by Heemstra and Randall (1984) could not be verified and is probably erroneous (Heemstra and Randall 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa (but not the Red Sea, Persian Gulf or South Africa) to the Society Islands, north to the Ryukyu Islands, south to northern Australia. Including most islands of the Indian Ocean and that of the west-central Pacific (Ref. 5222). Record from Rodriguez by Heemstra & Randall (1984, Ref. 3153) could not be verified and is probably erroneous (Ref. 33390).
  • Randall, J.E. and P.C. Heemstra 1991 Revision of Indo-Pacific groupers (Perciformes: Serranidae: Epinephelinae), with descriptions of five new species. Indo-Pac. Fish. (20):332 p. (Ref. 4787)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Northern Marianas, Line and Marquesas islands, north to Ryukyu Islands, south to Western Australia, Queensland (Australia) at 15°50'S, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 9 - 10
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 240 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

24.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Resembles C. urodeta, but always has a distinctive dark saddle on caudal peduncle (Ref. 37816); characterized further by reddish brown head with numerous red-orange or pinkish red spots, extending to pectoral region; mottled pinkish brown body; upper caudal-fin base with large dark brown saddle with smaller saddle just behind; upper part of caudal fin with dark brown streak, less intense streak on lower part; ctenoid scales on body including abdomen; greatest depth of body 2.6-2.9 in SL; rounded caudal fin; pelvic fins, 2.0-2.3 in head length (Ref 90102).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs in coral-rich areas of lagoon pinnacles, channels, and outer reef slopes. A secretive species, usually hiding in caves and crevices in the reefs. One of the smallest species of groupers known. Gut analysis revealed crustacean remains.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Cephalopholis leopardus is a reef-associated, non-migratory species found at depths of 1 to 40 m. Leopard Hind occur in coral-rich areas of lagoon pinnacles, channels, and outer reef slopes. The species is solitary (Myers 1999) and secretive, usually hiding in caves and crevices in the reefs. Leopard Hind are one of the smallest species of groupers known.

Feeding
Leopard Hind diet is omnivorous with a diet composed of fish and crustaceans.

Life history
The species reproduces late in life and has a low GSI. Leopard Hind seldom form schools and are often territorial. It exhibits low growth after first reproduction and has low mortality; life-span 7 to 12 years (Mellin et al. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 40 m (Ref. 9710), usually 3 - 20 m (Ref. 37816)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 107 specimens in 1 taxon.
Water temperature and chemistry ranges based on 87 samples.

Environmental ranges
  Depth range (m): 0.5 - 75.905
  Temperature range (°C): 22.841 - 29.336
  Nitrate (umol/L): 0.019 - 5.586
  Salinity (PPS): 32.185 - 35.248
  Oxygen (ml/l): 4.057 - 4.718
  Phosphate (umol/l): 0.055 - 0.494
  Silicate (umol/l): 0.897 - 9.181

Graphical representation

Depth range (m): 0.5 - 75.905

Temperature range (°C): 22.841 - 29.336

Nitrate (umol/L): 0.019 - 5.586

Salinity (PPS): 32.185 - 35.248

Oxygen (ml/l): 4.057 - 4.718

Phosphate (umol/l): 0.055 - 0.494

Silicate (umol/l): 0.897 - 9.181
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 40m.
From 1 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in the coral reefs of the Indo-West Pacific Region (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalopholis leopardus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGAACAGCCCTCAGCCTACTAATCCGGGCTGAACTAAGCCAACCAGGTGCTTTACTCGGCGATGATCAAATCTATAATGTGATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGTGGATTCGGAAACTGACTTATTCCACTAATAATTGGTGCCCCGGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGGCTTCTCCCCCCATCCTTCCTACTTCTGCTAGCCTCCTCTGGAGTAGAAGCTGGTGCTGGTACTGGTTGAACGGTGTATCCACCCTTAGCCGGTAACCTAGCCCACGCAGGTGCCTCTGTTGATCTAACCATCTTTTCTCTACATTTAGCAGGGATCTCATCAATTCTAGGAGCTATCAACTTCATTACTACCATTATTAACATAAAACCCCCTGCCATCTCCCAATACCAAACACCCTTATTTGTTTGAGCTGTATTAATTACAGCCGTTCTTCTCCTTCTCTCCCTTCCTGTCCTTGCTGCCGGTATTACAATGCTTTTAACAGACCGAAATCTTAATACTACCTTCTTCGACCCTGCCGGTGGGGGAGACCCGATCCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalopholis leopardus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Cabanban, A.S., Heemstra, P.C., Samoilys, M. & Kulbicki, M.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Cephalopholis leopardus is listed Least Concern as because it is widespread (although with variable abundance) and cryptic, and it is found in some well-managed marine parks within its range. The species is an incidental catch in the Live Reef Fish Trade and a non-target species in large-scale commercial fisheries. However, there are no quantitative data on its abundance in fisheries or in the wild from which to establish population trends. The species is reliant on coral reef habitat and is subject to the effects of global warming and habitat loss.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Cephalopholis leopardus has variable abundance across its range. It is common in the western Indian Ocean, but uncommon in the Great Barrier Reef and Reunion.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threat to Cephalopholis leopardus is habitat degradation from fish-bombing, sedimentation and eutrophication. It is not a specific target of commercial fisheries, although it is fished for subsistence purposes. The species is not commercially important in Papua New Guinea (Fry et al. 2006) and is recorded in the trap fisheries in Mozambique. It is typically lumped with other serranids in catch records. Leopard Hind are present in the Maldives live food fish trade; no export quota established for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Cephalopholis leopardus occurs within marine protected areas within some parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cephalopholis leopardus

Cephalopholis leopardus, also known as the Leopard grouper or Leopard hind , is a demersal Marine fish belonging to the family Serranidae.

Description[edit]

The Leopard grouper is a small medium sized fish which grows up to 24 cm.[2] The body is fusiform or spindle-shaped and compressed laterally. The caudal fin is rounded. The mouth is big and has a superior position. The body background coloration is light brown, reddish or light green-gray. On the top part of the body, blotches form marbling like pattern. The low part is spotted. The front snout is covered with small red or dark dots . The leopard grouper can easily be confused with Cephalopholis urodeta but it differs mainly from this latter by two dark blotches located on the top part of its caudal peduncle. The caudal fin is distinguished by two red to dark lines forming a "V" and another black line parallel to the top line of the "V".[3]

Distribution & habitat[edit]

It is widely distributed throughout the tropical waters of the Indian Ocean, Red Sea, Persian Gulf and South Africa excluded, to the central island of the Pacific Ocean.[4]

Like many of the groupers, Cephalopholis leopardus lives in rich clear waters close to coral or rocky reefs from the surface until 40 metres (130 ft) depth with an average depth range from 3 to 20 metres (66 ft).[5]

Feeding[edit]

Cephalopholis leopardus is carnivorous and its diet consists mainly in small fishes and crustaceans, it's an ambush predator.

Behavior[edit]

The leopard grouper is solitary, territorial, demersal and has an nocturnal and/or a diurnal activity which can be maximal at sunrise and/or at sunset.[6] It is protogynous hermaphrodite, which means the female can evolved to male during its life.

References[edit]

  1. ^ Cabanban, A.S., Heemstra, P.C., Samoilys, M. & Kulbicki, M. (2008). "Cephalopholis leopardus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2013-06-18. 
  2. ^ http://eol.org/pages/204625/details#size
  3. ^ Lieske & Myers,Coral reef fishes,Princeton University Press, 2009, ISBN 9780691089959
  4. ^ http://www.fishbase.org/summary/6448
  5. ^ http://eol.org/pages/204625/details#habitat
  6. ^ Brulé & Déniel, ‘’ Expose synoptique des données biologiques sur le mérou rouge Epinephelus morio (valenciennes, 1828) du Golfe du Mexique’’, F.A.O., 1994,ISBN 9252034633
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!