Overview

Comprehensive Description

Biology

In the Red Sea, it is often found on patchy open reef areas. Feeds diurnally on fishes (64%, mostly pomacentrids) and crustaceans (36%). It is a monogamous species, the pair jointly defends a common territory of up to 62 square m (Ref. 6480).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Cephalopholis hemistiktos has a disjunct distribution. It is known with certainty only from the northern end of the Red Sea, and then occurs on the northern coast of Oman to the Arabian Gulf and coast of Pakistan. And there are recent records from Socotra (Yemen) and mainland Somalia. Records from elsewhere are apparently based on misidentifications of other species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: only from the northern end of the Red Sea to the Persian Gulf and coast of Pakistan. Records from elsewhere are apparently based on misidentifications of other species. Misidentified as Cephalopholis miniatus by Kuronuma & Abe (1986, Ref. 5999) from Kuwait.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Northwestern Indian Ocean: Gulf of Aden and Persian Gulf (Arabian Gulf) to Pakistan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 8 - 10; Analspines: 3; Analsoft rays: 8 - 10
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 5222)); max. reported age: 26 years (Ref. 6451)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
In the Red Sea, C. hemistiktos is more often found on patchy open reef areas rather than on well developed coral reefs and occurs at depths ranging from 4 to at least 55 m. In Oman is abundant but patchily distributed on shallow coastal reefs. The greatest abundance is shown in central region (Muscat) with smaller number in the Arabian Gulf. In Oman on rocky reef substrata from 2 to 55 m. Abundant in the upwelling area of the Gulf of Oman despite local fishery.

Feeding
It is a diurnal, ambush predator feeding throughout the day on fishes (64%, mostly pomacentrids) and crustaceans (36%).

Reproduction
C. hemistiktos is a monogamous species and each pair jointly defends a common territory of up to 62 m² (Shpigel and Fishelson 1991).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 4 - 55 m (Ref. 5222)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 3 - 12

Graphical representation

Depth range (m): 3 - 12
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 55m.
From 4 to 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

More often occurs on patchy open reef areas rather than on well developed coral reefs in the Red Sea. An ambush predator which feeds throughout the day (Ref. 5222). Also in Ref. 9137.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalopholis hemistiktos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGAACAGCACTCAGCCTATTAATCCGGGCGGAACTAAGCCAACCAGGTGCTTTACTCGGCGATGATCAAATCTATAACGTAATTGTTACAGCACATGCTTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGTGGATTCGGAAACTGACTTATTCCACTAATGATCGGTGCCCCCGATATAGCATTCCCCCGAATGAATAATATGAGCTTCTGGCTCCTTCCCCCATCATTTCTGCTTCTGCTAGCCTCCTCTGGGGTAGAAGCTGGTGCTGGGACTGGTTGAACGGTATATCCGCCCTTAGCCGGTAACCTAGCCCACGCAGGTGCCTCTGTTGATCTTACTATCTTTTCTCTTCATTTAGCAGGAATTTCATCAATTCTAGGAGCTATTAACTTCATTACTACCATTATTAACATAAAACCCCCTGCCATCTCCCAATACCAAACACCACTATTTGTCTGAGCTGTGCTAATTACAGCCGTTCTTCTTCTCCTCTCTCTTCCTGTCCTTGCTGCTGGTATTACAATGCTTCTAACAGACCGAAATCTTAACACCACTTTCTTCGACCCTGCTGGCGGAGGAGACCCAATCCTTTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalopholis hemistiktos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Choat, J.H., Rocha, L., Ferreira, B., Bertoncini, A.A. & Craig, M.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Cephalopholis hemistiktos is listed as Near Threatened on the basis of predicted future decline of close to 30% based on increasing fishing effort in the future. This species is not as heavily fished as larger co-occurring groupers at present, but as these larger species decline and are no longer economically viable to target, it is expected that this species will become more of a focus of the fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Records from northern Oman show that Cephalopholis hemistiktos is one of the most abundant species of Cephalopholis recorded, however, abundance in other parts of its range is unknown. The population structure and abundance patterns of this species in Oman are highly variable. C. hemistiktos is abundant in the Gulf of Oman extending north beyond Musandam into the Arabian Gulf. To the south abundance drops sharply and this species is absent from reefs of the Arabian sea south of Ras al Hadd (McIlwain pers comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
General
The greatest threats to Cephalopholis hemistiktos are habitat loss and overfishing.

Fisheries
The yellowfin hind is not as heavily fished as larger co-occurring groupers at present, but as these larger species decline and are no longer economically viable to target, it is expected that this species will become more of a focus of the fisheries. It is heavily fished by line and trapping on central Oman coast. Weekly sampling in the Muttrah market from March 2004 to March 2005 revealed C. hemistiktos as the most abundant grouper, accounting for 34% of all grouper that were measured (by numbers). During the same time period, sampling the landings at Dibba in Musandam found that C. hemistiktos accounted for 16% of the total grouper landings. Logbooks filled out by Omani traditional fishermen from Barka (35 km north of Muscat) suggests C. hemistiktos accounts for 7.5% of the total catch (all fish species combined) and 42% of grouper species.

Not necessarily targeted in Musandam, but are caught as by-catch in traps that are set around reefs. This species is not targeted or caught by the Industrial trawl fishery which operates in the Arabian Sea where C. hemistiktos does not occur (J. McIlwain pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Cephalopholis hemistiktos is not protected by area management within its range of occurrence except in the Dyminiyats Islands in the Gulf of Oman. Marine Protected Areas (MPAs) will be required in the future. There is effort control on number of fisher licenses in Oman.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!