Overview

Comprehensive Description

Pseudoplatystoma fasciatum (Linnaeus, 1766)

(Figure 10, Table 1)

Silurus fasciatus Linnaeus, 1766 ZBK :505. Type locality: Brazil and Suriname. Mees (1974:129), as first revisor, restricted the type locality of P. fasciatum to Suriname . Holotype unknown.

Platystoma artedii Guenther , 1864 ZBK :164. Type locality: South America. Type(s): unknown.

Historical review. Linnaeus (1766) described Silurus fasciatus ZBK based on external morphology, including number of fin spines and rays, pigmentation, shape of the rostrum, and texture of the skin. Linnaeus mentioned in his original description the names of Gronovius and Seba, two reknowned cabinet owners (i.e., collectors) at that time. Linnaeus based his description on material owned by one of these gentlemen, apparently Albertus Seba. Engel (1961) and Boeseman (1970) tried to trace the ultimate destination of Seba's zoological material with the intention of helping taxonomists find type specimens. They concluded that only a small part of Seba's original material can be located accurately (Boeseman, 1970). His collections may have found their way to museums in Leningrad, Berlin, Bremen, Stockholm, and The Hague (Boeseman, 1970), as well as London and Paris. We have not been able to locate any type of Silurus fasciatus ZBK .

An English translation of Linnaeus’ original description is as follows:

"Posterior dorsal fin adipose. Anal fin with 13 rays, pelvics with 6 and spotted. Dorsal with 7 rays, caudal 17. Lower jaw short, rostrum flat and dark. Head long, flat, round anterior and reaching 1/2 the length of the body. Dorsum with black and white stripes on each side. Abdomen white. All fins sprinkled with black spots. Dorsal fin near the head, adipose near the tail. Habitat: Brazil and Suriname."

Linnaeus considered both Brazil and Suriname as the type locality of his Silurus fasciatus ZBK . We presume that the locality of Suriname is based directly on the collection that Seba made there in 1758 (Mees, 1974), whereas the reference to Brazil is based indirectly through Seba from Marcgrave (Mees, 1974). We follow Mees (1974:129), the first revisor, in restricting the type locality of P. fasciatum to Suriname.

Eigenmann and Eigenmann (1888, 1889) described four subspecies of P. fasciatum from the Amazon basin; P. f. brevifile ZBK , P. f. nigricans ZBK , P. f. intermedium ZBK and P. f. reticulatum ZBK . The allocation and taxonomic status of these names has not been clarified despite their repetition in standard catalogs (see Gosline, 1945; Fowler, 1915; Mees, 1974). Eigenmann and Allen (1942), Ringulet et al., (1967) and Mees (1974) placed these names in the synonymy of P. fasciatum . Conversely, we place the following names, P. fasciatum brevifile ZBK , P. fasciatum nigricans ZBK , P. fasciatum intermedium ZBK , in the synonymy of P. punctifer , a valid name applied to a species inhabiting the Amazon River (see P. punctifer account below). Pseudoplatystoma fasciatum reticulatum ZBK is elevated herein as P. reticulatum ZBK for a distinct population that inhabits the Parana and Amazon rivers (see below).

Neotype : FMNH 116903 , 516 mm SL, Linker Coppename River, ca. 1 km downstream from confluence of Midden and Linker Coppename rivers , 4°14’5.6”N , 56°36’5.8”W , Suriname , Ted Jantz et al. , 28 February 2004 .

Geographic distribution: Guyana region, including the Essequibo and Suriname rivers and their tributaries, in the countries of Guyana, Suriname, and French Guiana (Guyana) (Fig. 11).

FIGURE 10. Pseudoplatystoma fasciatum (Linnaeus, 1776) , INHS 48973, 516 mm SL.

FIGURE 11. Distribution of Pseudoplatystoma fasciatum (black squares), neotype is indicated by a star; and P. tigrinum (black circles).

Material examined: ANSP 175801 , (1), 188 yd. up stream from Essequibo campsite Maipuri , 4º45'43"N , 58º45'52"W , Essequibo River , county of Siparuni VIII -2 , Guyana , D. Allicock , 27 January 1997 . ANSP177346 , (1), (1 ds), Black Water camp , 4°44'00"N , 58°59'00"W , Siparuni River, Essequibo River , county of Essequibo , Guyana , G. Watkins et al. , 6 December 1997 . ANSP 8385 , (1), Suriname River , Suriname . ANSP 177351 , (1), rocky area 200m downstream from Paddle Rock campsite , 4°44'23"N , 58°42'42"W , Essequibo River , Guyana , D. Torres et al. , 6 December 1997 . BMNH 1866.8.14.159 , (1), Suriname , purchased by Damon . BMNH 1971.729.92.93 , (2; 1 ds), Karanambo pools, Rupununi River , Guyana , R. H. Lowe-McConnell , 1971 . BMNH 1866.8.14.158 , (1), Suriname , purchased by Damon . CAS 11626 , (2), Rupununi River , Guyana , C. H. Eigenmann , 1908 . INHS 48974 , (1 ds), Mazaruni-Potaro , 5°59'07.5"N , 58°33'02.9"W , Essequibo River , Guyana , J.W. Armbruster et al. , 19-20 October 1998 . INHS 48973 , (1), large sandbar & small cataract, 31.9 miles SSW Rockstone , 05°31'39.5"N , 58°37’43.6"W , Mazaruni-Potaro , Essequibo River , Guyana , J. W. Armbruster et al. , 21 October 1998 . NRM 6050 , (2), Suriname , Barnet-Lyon1991 . UF 16271 , (1), Marowijne River, at Albina , Suriname , Tjon-A-Hie , July-August 1967 . USNM 225437 , (3; 1 ds), Koekwie creek , 5°31'00"N , 57°10'00"W , Suriname , H. M. Madarie , 15 May 1980 .

Diagnosis: A species of Pseudoplatystoma ZBK distinguished by a combination of the following features: 42- 44 vertebrae versus 37-40 in the most similar species, P. punctifer (see Tables 1, 5 and 9); vertebral complex supporting Weberian apparatus longer than wide; skull at least 1/6 narrower than in other species; usually 10- 11 dark vertical bars, relatively wider than similar species from Amazon River; white vertical bars fewer than black vertical ones; generally, darker dorsally than congeners; pectoral and pelvic fins darker with few or no spots; bars posterior to head and opercle relatively more loop-like than straight; first spinelet of anal fin contacts haemal arch of 24th vertebra; conversely, it contacts haemal arch of 22nd vertebra in P. punctifer from Amazon River; last five vertebral centra shorter than in other species.

Description: Maximum size recorded 900 mm TL. Body moderately slender, profile of head an acute triangle, almost flat anteriorly. In dorsal view, head margins almost parallel, widening anteriorly. Anterior margin of mouth rounded, covered by thick skin. Body widest at pectoral fins, and gradually diminishing in width to caudal peduncle. Dorsal margin from dorsal fin to adipose fin somewhat concave, posterior to adipose fin straight. Ventral margin of body straight. Dorsal surface of cranium rough posteriorly with thin skin firmly attached, anterior region smooth with thicker skin. Middle fontanel extending along dorsal surface of head. Anterior nostril tubular, posterior one covered by small triangular flap. Eye dorsolateral, somewhat ovoid or circular at middle of head. Maxillary barbel very long, reaching beyond pelvic fin, dark dorsally, pale ventrally. Anterior ventral chin barbel shorter, 3/4 of the head length, pale. Posterior ventral chin barbel longer, reaching tip of pectoral spine, pale. Opercular margin pale.

Pigmentation somewhat regular in individuals of this species. Head and body dark dorsally and laterally. Dark pigmentation extending to the lateral line. Ventral region of body whitish. Darker bands present as vertical bars or loops. Vertical bars distributed along side posteriorly to pectoral fin and may reach ventral region of body; some of them with pale bars. Loops in area surrounding the dorsal fin. Dorsal fin rays with spots along their length. Adipose fin with small spots. Caudal fin with few spots, usually 29-40. Pectoral and pelvic fins usually dark. A comparison with other species of Pseudoplatystoma ZBK is in Table 9.

TABLE 1. Descriptive measurements of the body size and shape (in mm), and number of vertebrae for P. fasciatum . Number of individuals measured, 23.

Variables Neotype mean+SD range
Standard length 516 294.6+87.2 198.2-546.6
Snout-posterior occipital process 179.7 115.8+28.7 80-197.4
Snout-posterior margin of the opercle 179.7 111.3+29.5 87.3-194.8
Dorsal fin spine length 56.7 33.2+10 18.6-58.3
Pectoral fin spine length 76 45.5+13 27.8-80.3

...continued

TABLE 1. (continued)

Variables Neotype mean+SD range
Maxillary barbel length 219 156.1+29.6 111.3-209.4
Anterior chin barbel length 169.3 132+20.5 99.8-169.3
Insertion maxillary barbel -eye 72.5 46+10.5 30.6-72.5
Insertion maxillary barbel -joint pectoral spine 143.5 87+24.2 58.5-155.4
Insertion maxillary barbel -joint dorsal spine 201.6 122.9+32.3 83.8-209.8
Eye -joint pectoral spine 80.5 45.8+14 29.2-84.6
Eye -joint dorsal spine 129.5 76.7+21.1 52.7-134.4
Joint pectoral spine -joint dorsal spine 90.1 50.9+14.5 33-90.5
Joint pectoral spine -joint first pelvic ray 128.2 68.5+22.8 46.1-137.2
Joint pectoral spine -joint last ray of dorsal fin 114 65.7+18.9 43.2-119.8
Joint dorsal spine -joint first pelvic ray 101.2 50.9+18.8 34.1-107.5
Dorsal fin base length 38.9 22.3+7.2 14.2-41.9
Joint first pelvic ray -joint last dorsal fin ray 74.2 36.3+14.2 25.8-80.5
Joint first pelvic ray -anal fin origin 122.5 69+19.6 45.4-122.5
Joint first pelvic ray -origin adipose fin 131.8 71.6+20.4 50.2-131.8
Last dorsal fin ray -anal fin origin 153.9 84.4+26.2 60.5-153.9
Last dorsal fin ray -adipose fin origin 131 72.6+20.4 52.9-131
Anal fin origin -adipose fin origin 61.3 32.2+11.2 20.6-64.7
Anal fin base length 55.5 30.4+10.1 21.6-55.5
Anal fin origin -adipose fin terminus 62 33.6+11.1 24.5-66.1
Adipose fin origin -anal fin terminus 67.7 38.7+13 24-77.6
Adipose fin length 39.2 24.1+7.9 12.1-39.2
Anal fin terminus -adipose fin terminus 36.6 20.5+6.7 14.4-36.6
Anal fin terminus -ventral caudal fin origin 17.9 11.4+3.7 6.9-23.6
Anal fin terminus -dorsal caudal fin origin 34.4 21.3+5.9 15.9-39.2
Adipose fin terminus -ventral caudal fin origin 46.4 27.4+7.8 19.4-51.6
Adipose fin terminus -dorsal caudal fin origin 26.2 17.7+4.4 13.3-31.6
Caudal peduncle depth 31.9 17.9+5.4 12.6-31.9
Number of vertebra 43 43.2+0.83 42-44
  • Uriel Angel Buitrago-Suárez, Brooks M. Burr (2007): Taxonomy of the catfish genus Pseudoplatystoma Bleeker (Siluriformes: Pimelodidae) with recognition of eight species. Zootaxa 1512, 1-38: 8-11, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:A7987452-69A5-4C79-B0F2-29B889EA3E1B
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occurs throughout the principal riverbeds and sometimes in the flooded areas of forests. Its biology is similar to that of P. tigrinum but it appears to be more fond of shady streams. Feeds at night on fish (loricariids, cichlids and characoids) as well as crabs (Ref. 6868). Confines its foraging activities to riverbeds. Its yellowish flesh is succulent and like that of other silurids, it is without bones (Ref. 27188). Females reach a more notable size. They become sexually mature at 56 cm, males at 45 cm. Fecundity is estimated at 8 million eggs per kg (Ref. 35381). Utilized for human consumption.
  • Lundberg, J.G. and M.W. Littmann 2003 Pimelodidae (Long-whiskered catfishes). p. 432-446. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36506)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

South America: Amazon, Corantijn, Essequibo, Orinoco and Paraná River basins.
  • Lundberg, J.G. and M.W. Littmann 2003 Pimelodidae (Long-whiskered catfishes). p. 432-446. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36506)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Guyana region: Guyana, Suriname and (French) Guyana.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 900 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

104 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 70.0 kg (Ref. 35381)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; potamodromous (Ref. 51243); freshwater; pH range: 6.0 - 8.0; dH range: 4 - 30; depth range 5 - ? m
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Known to occur at a temperature range of 24-29.8 °C, pH range of 5-9, and an alkalinity range of 42-142 (Ref. 9084).
  • Goulding, M. 1981 Man and fisheries on an Amazon frontier. In H.J. Dumont (ed.). Developments in Hydrobiology, v. 4. The Hague: W. Tunk Publishers. 137 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Eustrongylides Infestation 2 (Larvae). Parasitic infestations (protozoa, worms, etc.)
  • Moravec, F. 1998 Nematodes of freshwater fishes of the neotropical region. 464 p. Praha, Academy of Sciences of the Czech Republic. (Ref. 51153)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dichelyne Infestation 3. Parasitic infestations (protozoa, worms, etc.)
  • Moravec, F. 1998 Nematodes of freshwater fishes of the neotropical region. 464 p. Praha, Academy of Sciences of the Czech Republic. (Ref. 51153)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudoplatystoma fasciatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 143 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGTACAGCCCTTAGCCTACTAATTCGGGCAGAGCTGGCCCAACCCGGCGCCCTTCTAGGTGATGACCAAATTTACAACGTCATTGTAACTGCTCATGCCTTTGTAATAATTTTCTTTATAGTGATACCCATTATGATCGGGGGATTTGGAAACTGATTAATCCCACTAATAATTGGGGCACCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTTCCCCCATCCTTCTTACTTCTGCTTGCCTCGTCTGGGGTAGAAGCAGGAGCAGGAACAGGCTGAACTGTCTATCCTCCCCTTGCAGGGAATCTAGCACACGCCGGAGCTTCTGTAGATCTAACTATTTTCTCCCTACATCTAGCAGGGGTGTCATCCATCCTAGGAGCCATTAACTTTATTACAACCATCATCAACATAAAACCCCCCTCTATCTCACAATATCAAACACCATTATTTGTATGATCAGTCCTAATTACAGCTGTACTTCTTCTACTATCCCTCCCCGTCTTAGCCGCAGGCATTACAATGTTACTAACAGACCGAAACCTAAATACTACATTCTTTGACCCAGCAGGAGGAGGAGACCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudoplatystoma fasciatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 147
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pseudoplatystoma fasciatum

Pseudoplatystoma fasciatum or barred sorubim is a species of long-whiskered catfish native to the Corantijn, Essequibo, Orinoco, Paraná and Amazon Basins. The nocturnal predator feeds mainly on other fish and crabs.[1] Females reach a more notable size. They become sexually mature at 56 cm (22 in), males at 45 cm (18 in) and this species reaches a maximum length of 104 cm (41 in) TL. Fecundity seems to be estimated at 8 million eggs per kg,[2] but was recently measured in aquaculture at a lower, and more likely) level of 150 000 eggs laid per kg.[3]

Subspecies[edit]

According to Riehl and Haensch, five subspecies have been described:[4]

However, Buitrago–Suárez and Burr place P. f. brevifile, P. f. intermedium, and P. f. nigricans, in the synonymy of P. punctifer. P. f. reticulatum is elevated as another distinct species P. reticulatum.[5]

Currently, all subspecies except P. f. reticulatum are considered synonyms of P. fasciatum.[1]

Reproduction and rearing[edit]

The species is of interest for aquaculture for food production (and indirectly as conservation measure because it may lower the fishing pressure on wild population), as well as for production of fish for aquariologists. Maturation in earthern tanks of fish caught in the wild is not problematic, since manipulation of fish during fishing and transportation is well done. Reproduction may be obtained with two injections of OVAPRIM® in 24 hours (10% and 90% of the recommended dosis, respectively), ovulation occurs after around 8 hr at 27 °C.[3] Incubation of eggs is carried out in "Zug" jars and hatching occurs 24 hours after fertilization at 26,5 °C. Vitelus resorbtion takes 3 days but larvae start feeding 2 days after hatching, and may start active cannibalism at this moment. Feeding may start 48 hours post-hatching with freshly hatched artemia nauplii, seven times a day. Larvae must be kept in the dark in order to maximize uniform distribution of larvae in the tanks and therefore food availability.[6] After 15 days, food may be completed and then replaced gradually with ground mammalian liver. After 20 days post hatching, fingerling may be fed high quality pelleted food adapted to their size.

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2012). "Pseudoplatystoma fasciatum" in FishBase. February 2012 version.
  2. ^ Le Bail, P.-Y, P. Keith and P. Planquette. Atlas des poissons d'eau douce de Guyane (tome 2, fascicule II). Publications scientifiques du M.N.H.N, Paris, p. 307 (2000)
  3. ^ a b Nuñez et al, 2008. Induced breeding and larval rearing of Surubi, Pseudoplatystoma fasciatum (Linnaeus, 1766), from the Bolivian Amazon , DOI: 10.1111/j.1365-2109.2008.01928.x
  4. ^ Riehl, R. and Baensch, H.A. Mergus Aquarien Atlas p. 510 (2002) 14. edt.
  5. ^ Buitrago–Suárez, U.A. and Burr, B.M. Taxonomy of the catfish genus Pseudoplatystoma Bleeker (Siluriformes: Pimelodidae) with recognition of eight species Zootaxa 1512 p. 1-38 (2007)
  6. ^ Baras et al, 2011. How many meals a day to minimize cannibalism when rearing larvae of the Amazonian catfish Pseudoplatystoma punctifer? DOI:10.1051/alr/2011141 www.alr-journal.org
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!