Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit coastal to outer reef crest and slopes with rich invertebrate growth. Sometimes solitary (Ref. 90102). Adults often in pairs (Ref. 48637). Feed on corals (usually Acropora tips), crustaceans, mollusks, sponges, tunicates and algae (Ref. 2334). Generally common (Ref. 9710).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to Micronesia and Samoa, north to southern Japan, south to New South Wales. Replaced by Arothron diadematus in the Red Sea (Ref. 37816, Ref. 84159).
  • Randall, J.E. 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p. (Ref. 11441)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Line Islands and Tuamotu Islands, north to Ryukyu Islands and Ogasawara Islands, south to New South Wales (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 11; Analspines: 0; Analsoft rays: 10 - 12
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 330 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

33.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body covered with prickles (Ref. 559) and with large black spots (Ref. 4919).Description: Characterized further by having variable pattern, often pale grey with dark patches around eye and on snout; top of snout with white bar across; widely scattered black spots; sometimes with little amount of yellow color on head and body; small spinules on head and body except around mouth, caudal peduncle and variable area of back, more developed spinules on ventral surface; short snout, length 2.0-2.5 in head length; rounded caudal fin, length 3.0-4.0 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits coral reefs and feeds on corals (usually @Acropora tips@), crustaceans, mollusks, sponges, tunicates and algae (Ref. 2334)
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 25 m (Ref. 30874)
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 70 specimens in 1 taxon.
Water temperature and chemistry ranges based on 47 samples.

Environmental ranges
  Depth range (m): 0.61 - 44
  Temperature range (°C): 25.335 - 29.336
  Nitrate (umol/L): 0.052 - 1.251
  Salinity (PPS): 32.200 - 36.148
  Oxygen (ml/l): 4.427 - 4.757
  Phosphate (umol/l): 0.083 - 0.351
  Silicate (umol/l): 1.089 - 4.465

Graphical representation

Depth range (m): 0.61 - 44

Temperature range (°C): 25.335 - 29.336

Nitrate (umol/L): 0.052 - 1.251

Salinity (PPS): 32.200 - 36.148

Oxygen (ml/l): 4.427 - 4.757

Phosphate (umol/l): 0.083 - 0.351

Silicate (umol/l): 1.089 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 25m.
From 3 to 25 meters.

Habitat: reef-associated. Blackspotted puffer.  (Bloch & Schneider, 1801)  
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coastal to outer reef crest and slopes with rich invertebrate growth. Adults often in pairs (Ref. 48637). Feeds on corals (usually Acropora tips), crustaceans, mollusks, sponges, tunicates and algae (Ref. 2334, 54301). Generally common (Ref. 9710).
  • Sano, M., M. Shimizu and Y. Nose 1984 Food habits of teleostean reef fishes in Okinawa Island, southern Japan. University of Tokyo Bulletin, no. 25. v,128p. University of Tokyo Press, Tokyo, Japan. 128 p. (Ref. 6110)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arothron nigropunctatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACGGCCCTTAGCCTTCTCATTCGGGCTGAACTCAGCCAACCAGGCGCACTCCTGGGCGACGATCAAATTTATAACGTAATCGTCACAGCCCACGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGCTTCGGGAACTGACTGGTACCACTCATGATTGGAGCCCCTGACATGGCATTCCCTCGAATGAATAACATAAGCTTTTGACTGCGTCCCCCTTCCTTCCTCCTTCTCCTGGCATCCTCTGGTGTAGAAGCGGGAGCTGGTACAGGCTGAACCGTCTACCCACCACTGGCGGGTAATTTAGCCCACGCAGGAGCATCTGTCGACCTTACCATTTTCTCCCTCCACTTAGCGGGTGTCTCATCAATTCTTGGCGCCATTAACTTCATCACCACAATCATCAACATAAAACCCCCAGCCATCTCTCAATACCAAACACCCCTGTTCGTATGAGCCGTTTTAATCACCGCCGTCCTTCTCTTGTTATCCCTGCCAGTCCTCGCAGCCGGTATCACGATGCTCCTTACAGACCGAAACCTAAACACCACCTTCTTCGATCCTGCAGGCGGAGGGGACCCAATCCTCTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arothron nigropunctatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: public aquariums
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blackspotted puffer

The blackspotted puffer (Arothron nigropunctatus), also known as the dog-faced puffer, is a tropical marine fish belonging to the family Tetraodontidae.

Description[edit]

Arothron nigropunctatus is a small sized fish which grows up to 33 cm (1 ft) length.[1] Its body is oval shape, spherical et relatively elongated. The skin is not covered with scales. The fish has no pelvic fin and no lateral line.The dorsal fin and the anal fin are small, symmetric and located at the end of the body. Its snout is short with two pairs of nostrils and its mouth is terminal with four strong teeth.[2]

The background coloration is variable and can be grey, light brown, bluish, bluish dark, bright yellow, orangey yellow and also sometimes bi-color like bluish and yellow. Dark coloration occurs around the eyes and the mouth. The skin is strewed with dark blotches which vary in size and shape.

Distribution and habitat[edit]

This species is found in tropical waters from the Indian Ocean to the central islands of the Pacific Ocean, roughly equalling the Indo-Pacific, except the Red Sea.[3] It lives close to external reef slopes and lagoons from the surface to 25 m (82 ft) depth.[4]

Feeding[edit]

Arothron nigropunctatus feeds on benthic invertebrates, sponges, algaes, coral like Acropora tips, crustaceans and mollusks.[5]

Behaviour[edit]

This pufferfish is diurnal, solitary and territorial.[2]

Potential danger[edit]

Arothron nigropunctatus holds the deadly poison tetrodotoxin, which protect it from predators. In order to ward off potential enemies, they can inflate their bodies by swallowing air or water.

References[edit]

  1. ^ http://www.fishbase.org/summary/Arothron-nigropunctatus.html
  2. ^ a b Lieske & Myers,Coral reef fishes, Princeton University Press, 2009, ISBN 9780691089959
  3. ^ http://eol.org/pages/204574/details#distribution
  4. ^ http://www.fishbase.org/summary/Arothron-nigropunctatus.html
  5. ^ http://eol.org/pages/204574/details#trophic_strategy
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!