Overview

Comprehensive Description

Biology

Adults usually found near the bottom from inshore waters to at least 54 m depth, but may form schools near the surface (Ref. 5217). Juveniles are found on muddy bottoms brackish estuaries and in coastal marine waters (Ref. 5217). Feeds on small fishes and crustaceans. Good food fish and marketed fresh.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Nova Scotia, Canada through most of the West Indies; along coasts of Gulf of Mexico and South America to Mar del Plata, Argentina. Absent from the Bahamas
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Nova Scotia, Canada through most of the West Indies; along coasts of Gulf of Mexico and South America (Ref. 26938) to Mar del Plata, Argentina. Absent from the Bahamas (Ref. 26938). Replaced by Selene dorsalis in the eastern Atlantic. These two species have not been adequately studied and may prove to be conspecific. Known to occur in Mauritania (Ref. 5377).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Cape Cod to Uruguay but stray to Nova Scotia; common from Chesapeake Bay southward.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendricks, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 21; Analspines: 3; Analsoft rays: 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 4,600 g (Ref. 26340)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 60.0 cm TL (male/unsexed); max. weight: 4,600.0 g.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendricks, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Pelvic fin small (Ref. 13608). A very deep-bodied, short and strongly compressed fish. Facial profile nearly vertical and concave. Pelvic fin very short (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults usually found near the bottom from inshore waters to at least 54 m depth, but may form schools near the surface.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; brackish; marine; depth range ? - 55 m (Ref. 26912)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1014 specimens in 1 taxon.
Water temperature and chemistry ranges based on 297 samples.

Environmental ranges
  Depth range (m): 0 - 800
  Temperature range (°C): 7.856 - 27.556
  Nitrate (umol/L): 0.289 - 29.702
  Salinity (PPS): 32.507 - 36.472
  Oxygen (ml/l): 2.969 - 6.744
  Phosphate (umol/l): 0.053 - 1.900
  Silicate (umol/l): 0.756 - 17.695

Graphical representation

Depth range (m): 0 - 800

Temperature range (°C): 7.856 - 27.556

Nitrate (umol/L): 0.289 - 29.702

Salinity (PPS): 32.507 - 36.472

Oxygen (ml/l): 2.969 - 6.744

Phosphate (umol/l): 0.053 - 1.900

Silicate (umol/l): 0.756 - 17.695
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 55m.
Recorded at 55 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; brackish; marine; depth range to 55 m. Adults may school near the surface but usually are near the bottom. Juveniles occur on mud bottoms of brackish estuaries or coastal marine waters.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendricks, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Adults usually found near the bottom from inshore waters to at least 54 m depth, but may form schools near the surface. Juveniles are found on muddy bottoms brackish estuaries and in coastal marine waters. Feeds on small fishes and crustaceans.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on small fishes and crustaceans.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendricks, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on small fishes and crustaceans.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawning season in late summer; eggs are pelagic.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendricks, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Selene setapinnis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Selene setapinnis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCTTGAGCCGGAATGGTAGGTACAGCTTTAAGCCTACTTATTCGAGCAGAACTAAGCCAACCTGGCGCCCTTCTAGGGGACGACCAAATTTACAACGTCATTGTTACGGCCCACGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATAATTGGAGGCTTCGGAAACTGACTTATCCCACTAATGATCGGAGCTCCAGATATAGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCTCCCTCTTTCCTTCTACTCTTAGCCTCTTCAGGGGTTGAAGCCGGGGCTGGAACAGGTTGAACAGTATATCCCCCACTAGCTGGAAACCTTGCTCACGCCGGAGCATCCGTCGATTTAACCATCTTCTCCCTTCATCTAGCGGGGGTCTCATCGATTCTAGGGGCTATTAATTTTATCACCACTATTATCAACATGAAACCTCCTGCAGTTTCAATATACCAAATCCCACTATTTGTATGAGCTGTTTTGATTACAGCCGTCCTACTCCTTCTTTCCCTGCCAGTCCTAGCTGCCGGTATTACAATGCTTCTAACGGATCGGAACCTGAATACTGCTTTCTTCGACCCGGCCGGAGGGGGTGATCCTATCCTTTACCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquarium: public aquariums; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!