Skip to content

Xanthichthys auromarginatus — Details

Bluechin Guilded Triggerfish learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Occur in upper margins of current-swept seaward drop-offs and ledges (Ref. 205, 48637). Current-prone and with rich invertebrate growth such as seawhips. Usually found at moderate depths over 20 meters and occuring in small loose groups (Ref. 48637). Benthopelagic (Ref. 58302). Form loose aggregations a few meters above the bottom where it feeds on zooplankton, particularly copepods. Oviparous (Ref. 205). Also taken by drive-in nets (Ref. 9770).

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Distribution

Learn more about this article

Chagos, Mauritius, Reunion, South Africa (country)

Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Indo-Pacific: East Africa to the Hawaiian Islands, north to the Ryukyus, south to Cocos-Keeling Atoll and New Caledonia.

Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816) http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 3; Dorsal soft rays (total): 27 - 30; Analspines: 0; Analsoft rays: 25 - 27

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Size

Learn more about this article

Maximum size: 300 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Max. size

Learn more about this article

30.0 cm TL (male/unsexed; (Ref. 30874))

Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874) http://www.fishbase.org/references/FBRefSummary.php?id=30874&speccode=10294

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Diagnostic Description

Description

Learn more about this article

Occurs in upper margins of current-swept seaward drop-offs and ledges. Forms loose aggregations a few meters above the bottom where it feeds on zooplankton, particularly copepods. Also taken by drive-in nets (Ref. 9770).

Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Females lack the blue chins of males.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Learn more about this article

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 35 - 57
  Temperature range (°C): 20.792 - 26.317
  Nitrate (umol/L): 0.822 - 1.018
  Salinity (PPS): 34.753 - 35.639
  Oxygen (ml/l): 4.483 - 5.040
  Phosphate (umol/l): 0.189 - 0.215
  Silicate (umol/l): 1.104 - 4.102

Graphical representation

Depth range (m): 35 - 57

Temperature range (°C): 20.792 - 26.317

Nitrate (umol/L): 0.822 - 1.018

Salinity (PPS): 34.753 - 35.639

Oxygen (ml/l): 4.483 - 5.040

Phosphate (umol/l): 0.189 - 0.215

Silicate (umol/l): 1.104 - 4.102

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Depth: 8 - 150m.
From 8 to 150 meters.

Habitat: reef-associated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Environment

Learn more about this article

reef-associated; marine; depth range 8 - 150 m (Ref. 9770), usually 24 - 147 m (Ref. 1602)

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770) http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Distinct pairing (Ref. 205).

Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240) http://www.fishbase.org/references/FBRefSummary.php?id=240&speccode=1263

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Xanthichthys auromarginatus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 9 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GBGC6303-09|NC_011945|Xanthichthys auromarginatus| ACACGTTGACTCTTCTCAACTAATCATAAAGACATCGGCACCTTATACCTGATTTTCGGTGCTTGAGCCGGGATAGTGGGCACAGCCTTA---AGCTTACTAATCCGAGCAGAACTAAACCAACCCGGCGCTCTCTTAGGAGAC---GATCAGATTTATAACGTTATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTTATCCCCTTAATA---ATTGGGGCCCCCGACATGGCATTCCCTCGTATGAACAACATAAGCTTTTGGCTTCTGCCCCCTTCACTTCTCCTCCTCCTTGCTTCATCAAGCGTAGAAGCGGGAGCCGGGACCGGGTGAACAGTGTACCCCCCACTCGCAGGAAATCTAGCCCACGCAGGGGCTTCTGTAGACCTT---ACCATCTTTTCACTCCATCTGGCAGGAATTTCCTCCATTCTTGGGGCAATCAACTTCATTACAACCATTATTAACATGAAACCCCCCGCTATTTCTCAGTATCAGACGCCTCTATTTGTTTGAGCTGTTCTAATCACAGCGGTGCTTCTCCTCTTATCCCTCCCTGTCTTAGCTGCC---GGAATTACTATATTACTTACCGACCGAAATTTAAACACCACTTTCTTTGACCCTGCTGGAGGTGGTGACCCCATTCTTTACCAACATTTATTCTGATTCTTCGGCCACCCAGAAGTGTATATTCTTATTCTCCCCGGCTTTGGAATAATCTCACATATTGTCGCCTACTACTCAGGCAAAAAA---GAACCTTTCGGTTACATAGGAATGGTTTGAGCCATAATGGCCATTGGACTCCTAGGCTTCATCGTCTGAGCCCACCACATGTTCACAGTGGGAATGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Xanthichthys auromarginatus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Species: 11
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: subsistence fisheries; aquarium: commercial

Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358) http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306
Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770) http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Gilded triggerfish

Learn more about this article

The gilded triggerfish or blue-throated Triggerfish, Xanthichthys auromarginatus, is a spotted gray triggerfish. Males of the species have blue cheeks and yellow-bordered white fins. They can grow up to 22 centimetres (8.7 in) in length. It is widely, but locally, distributed at islands in the Indo-Pacific.

In the aquarium

Unlike most triggerfish, it is rarely aggressive towards other fish. It needs a minimum size tank of 75 gallons.^{[citation needed]} When it gets settled it likes to swims in the open waters above rocky or sandy substrates. This triggerfish is one of the only triggerfish that will breed in the home aquarium.^{[citation needed]} This fish should not harm any sessile invertebrates but may eat ornamental shrimps. Males have a blue throat patch and a bright yellow edge to the tail, dorsal and ventral fins.

References

This Tetraodontiformes article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!