Overview

Comprehensive Description

Biology

Adults occur in shallow sandy or mixed sand, rubble, or coral areas of reef flats and lagoons, also sometimes on seaward reefs (Ref. 1602). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205). Males may be brooding at 6.5-7.0 cm SL.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Pacific: Borneo to Samoa, north to Marshall and Mariana Islands, south to Rowley Shoals and New Caledonia; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwestern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 2632
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 160 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

16.0 cm SL (male/unsexed; (Ref. 1602))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in shallow sandy or mixed sand, rubble, or coral areas of reef flats and lagoons, also sometimes on seaward rees to a depth of at least 20 m. Males may be brooding at 6.5 - 7.0 cm SL.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Corythoichthys intestinalis
Catalog Number: USNM 51723
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 20 - 68 m (Ref. 9710), usually ? - 68 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 73 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 0.305 - 68
  Temperature range (°C): 24.049 - 29.336
  Nitrate (umol/L): 0.050 - 0.265
  Salinity (PPS): 34.090 - 35.503
  Oxygen (ml/l): 4.441 - 4.855
  Phosphate (umol/l): 0.083 - 0.216
  Silicate (umol/l): 0.974 - 1.684

Graphical representation

Depth range (m): 0.305 - 68

Temperature range (°C): 24.049 - 29.336

Nitrate (umol/L): 0.050 - 0.265

Salinity (PPS): 34.090 - 35.503

Oxygen (ml/l): 4.441 - 4.855

Phosphate (umol/l): 0.083 - 0.216

Silicate (umol/l): 0.974 - 1.684
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154). Occurs in shallow sandy or mixed sand, rubble, or coral areas of reef flats and lagoons, also sometimes on seaward reefs (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corythoichthys intestinalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAATCTTCGGTGCCTGGGCCGGAATGGTGGGCACTGCCCTTAGCCTACTGATCCGGGCAGAACTCAACCAACCAGGTGCATTACTAGGGGACGACCAGATCTATAATGTAATCGTCACCGCTCACGCATTTGTAATAATCTTTTTCATGGTCATGCCCATCATGATTGGAGGCTTCGGCAACTGGCTGGTACCCCTAATGATTGGCGCCCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGGCTTCTTCCTCCATCTTTTCTTCTTCTCTTAGCCTCTTCTGGCGTAGAAGCGGGGGCGGGGACAGGCTGAACAGTATACCCGCCGCTTGCCGGGAATTTAGCGCATGCGGGAGCCTCTGTAGACCTTACTATCTTTTCCCTGCACCTGGCGGGCGTATCCTCAATCCTCGGGGCTATCAACTTTATTACCACCATTGTCAACATAAAGCCGCCTTCTATTTCACAATACCAAACGCCCCTTTTCGTTTGAGCCGTACTAATCACCGCGGTACTGCTTCTTCTTTCCCTGCCCGTCCTAGCAGCGGGGATCACAATGCTGCTAACTGACCGCAACCTCAACACCACTTTTTTTGACCCAGCTGGGGGAGGTGATCCAATCTTGTACCAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corythoichthys intestinalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!