Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found among algal-matted rock and living corals of lagoon and seaward reefs from the low tide line to a depth of 25 m or more. Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
  • Dawson, C.E. 1985 Indo-Pacific pipefishes (Red Sea to the Americas). The Gulf Coast Research Laboratory Ocean Springs, Mississippi, USA. (Ref. 5316)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (Ref. 33390) to the Tuamoto Islands, north to Ryukyu Islands, south to northern Australia (Ref. 33390) and the Austral Islands.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indian Ocean: East Africa, Comores, Madagascar, Aldabra, Amirantes, Réunion, Mauritius and Rodrigues (Mascarenes) east to Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 2636
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 120 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Neotype for Corythoichthys flavofasciatus
Catalog Number: USNM 214919
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, L. Hughes-Gannes, A. Levy, H. Harpaz & P. Raber
Year Collected: 1969
Locality: Israel, Et-Tur, Sinai Peninsula, Gulf of Suez 100 km; N of Sharm el Sheikh as road goes., Egypt, Gulf of Suez, Red Sea, Indian
Depth (m): 9
  • Neotype: Dawson, C. E. 1977. Copeia. 1977 (2): 309.; Ruppell, E. 1838. Neue Wirbelthiere zu der Fauna von Abyssinien gehorig. Fische des Rothen meeres. 4: 144.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Corythoichthys flavofasciatus
Catalog Number: USNM 51722
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Holotype: Jordan, D. S. & Starks, E. C. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 213, fig. 18.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Corythoichthys flavofasciatus
Catalog Number: USNM 337920
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Paratype: Jordan, D. S. & Starks, E. C. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 213, fig. 18.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 25 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 63 specimens in 1 taxon.
Water temperature and chemistry ranges based on 47 samples.

Environmental ranges
  Depth range (m): 0.5 - 35
  Temperature range (°C): 25.275 - 29.336
  Nitrate (umol/L): 0.047 - 0.644
  Salinity (PPS): 32.200 - 40.307
  Oxygen (ml/l): 4.427 - 4.807
  Phosphate (umol/l): 0.085 - 0.339
  Silicate (umol/l): 1.073 - 4.752

Graphical representation

Depth range (m): 0.5 - 35

Temperature range (°C): 25.275 - 29.336

Nitrate (umol/L): 0.047 - 0.644

Salinity (PPS): 32.200 - 40.307

Oxygen (ml/l): 4.427 - 4.807

Phosphate (umol/l): 0.085 - 0.339

Silicate (umol/l): 1.073 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 25m.
Recorded at 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found among algal-matted rock and living corals of lagoon and seaward reefs from the low tide line to a depth of 25 m or more (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corythoichthys flavofasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATATATAATCTTCGGTGCATGAGCCGCGATAGTGGGCACCGCCCTCAGTCTGCTGATCCGAGCAGAGCTCGGTCAACCAGGGGCACTTCTAGGTGATGACCAACTTTATAATGTAATCGTTACCGCCCACGCATTCGTAATAATCTTTTTCATAGTAATACCCATCATGATCGGCGGCTTCGGCAACTGATTAGTGCCTTTAATAATTGGCGCCCCCGACATGGCATTCCCCCGAATGAATAATATGAGCTTCTGACTTCTTCCGCCTTCTTTTCTTCTTCTATTAGCCTCTTCAGGGGTAGAAGCGGGGGCCGGAACAGGTTGAACGGTGTACCCTCCCCTTGCCGGCAACTTAGCGCACGCAGGGGCCTCTGTAGACCTCACTATTTTTTCCCTCCACCTGGCGGGGGTGTCATCAATTCTAGGCGCGATTAACTTTATTACCACTATTATTAACATAAAACCCCCATCCGTCTCACAGTACCAAACACCTCTCTTCGTGTGAGCTGTGCTTATTACTGCAGTACTTCTTCTTCTCTCTCTACCCGTTTTAGCAGCAGCAATTACAATACTGCTGACCGACCGTAATCTCAATACCACTTTTTTCGACCCTGCCGGAGGGGGTGACCCTATTTTATACCAACACTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corythoichthys flavofasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!