Overview
Comprehensive Description
Biology
Found among algal-matted rock and living corals of lagoon and seaward reefs from the low tide line to a depth of 25 m or more. Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
-
Dawson, C.E. 1985 Indo-Pacific pipefishes (Red Sea to the Americas). The Gulf Coast Research Laboratory Ocean Springs, Mississippi, USA. (Ref. 5316)
http://www.fishbase.org/references/FBRefSummary.php?id=5316&speccode=46103
Trusted
Distribution
Indo-Pacific: Red Sea and East Africa (Ref. 33390) to the Tuamoto Islands, north to Ryukyu Islands, south to northern Australia (Ref. 33390) and the Austral Islands.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Chagos, Comores, Kenya, Madagascar, Mauritius, Red Sea, Reunion, Rodriguez, Seychelles
-
Randall, J.E. (1992). Red Sea Reef Fishes. Immel Publishing.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6091
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Red Sea, Indian Ocean: East Africa, Comores, Madagascar, Aldabra, Amirantes, Réunion, Mauritius and Rodrigues (Mascarenes) east to Indonesia.
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 2636
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
12.0 cm TL (male/unsexed; (Ref. 9710))
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Type Information
Neotype for Corythoichthys flavofasciatus
Catalog Number: USNM 214919
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, L. Hughes-Gannes, A. Levy, H. Harpaz & P. Raber
Year Collected: 1969
Locality: Israel, Et-Tur, Sinai Peninsula, Gulf of Suez 100 km; N of Sharm el Sheikh as road goes., Egypt, Gulf of Suez, Red Sea, Indian
Depth (m): 9
Catalog Number: USNM 214919
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, L. Hughes-Gannes, A. Levy, H. Harpaz & P. Raber
Year Collected: 1969
Locality: Israel, Et-Tur, Sinai Peninsula, Gulf of Suez 100 km; N of Sharm el Sheikh as road goes., Egypt, Gulf of Suez, Red Sea, Indian
Depth (m): 9
- Neotype: Dawson, C. E. 1977. Copeia. 1977 (2): 309.; Ruppell, E. 1838. Neue Wirbelthiere zu der Fauna von Abyssinien gehorig. Fische des Rothen meeres. 4: 144.
Trusted
Holotype for Corythoichthys flavofasciatus
Catalog Number: USNM 51722
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
Catalog Number: USNM 51722
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
- Holotype: Jordan, D. S. & Starks, E. C. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 213, fig. 18.
Trusted
Paratype for Corythoichthys flavofasciatus
Catalog Number: USNM 337920
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
Catalog Number: USNM 337920
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
- Paratype: Jordan, D. S. & Starks, E. C. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 213, fig. 18.
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range ? - 25 m (Ref. 9710)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Depth range based on 63 specimens in 1 taxon.
Water temperature and chemistry ranges based on 47 samples.
Environmental ranges
Depth range (m): 0.5 - 35
Temperature range (°C): 25.275 - 29.336
Nitrate (umol/L): 0.047 - 0.644
Salinity (PPS): 32.200 - 40.307
Oxygen (ml/l): 4.427 - 4.807
Phosphate (umol/l): 0.085 - 0.339
Silicate (umol/l): 1.073 - 4.752
Graphical representation
Depth range (m): 0.5 - 35
Temperature range (°C): 25.275 - 29.336
Nitrate (umol/L): 0.047 - 0.644
Salinity (PPS): 32.200 - 40.307
Oxygen (ml/l): 4.427 - 4.807
Phosphate (umol/l): 0.085 - 0.339
Silicate (umol/l): 1.073 - 4.752
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 47 samples.
Environmental ranges
Depth range (m): 0.5 - 35
Temperature range (°C): 25.275 - 29.336
Nitrate (umol/L): 0.047 - 0.644
Salinity (PPS): 32.200 - 40.307
Oxygen (ml/l): 4.427 - 4.807
Phosphate (umol/l): 0.085 - 0.339
Silicate (umol/l): 1.073 - 4.752
Graphical representation
Depth range (m): 0.5 - 35
Temperature range (°C): 25.275 - 29.336
Nitrate (umol/L): 0.047 - 0.644
Salinity (PPS): 32.200 - 40.307
Oxygen (ml/l): 4.427 - 4.807
Phosphate (umol/l): 0.085 - 0.339
Silicate (umol/l): 1.073 - 4.752
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 0 - 25m.
Recorded at 25 meters.
Habitat: reef-associated.
Recorded at 25 meters.
Habitat: reef-associated.
Trusted
Trophic Strategy
Found among algal-matted rock and living corals of lagoon and seaward reefs from the low tide line to a depth of 25 m or more (Ref. 205).
Trusted
Life History and Behavior
Life Cycle
Male carries the eggs in a brood pouch (Ref. 205).
-
Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Corythoichthys flavofasciatus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CACCCTATATATAATCTTCGGTGCATGAGCCGCGATAGTGGGCACCGCCCTCAGTCTGCTGATCCGAGCAGAGCTCGGTCAACCAGGGGCACTTCTAGGTGATGACCAACTTTATAATGTAATCGTTACCGCCCACGCATTCGTAATAATCTTTTTCATAGTAATACCCATCATGATCGGCGGCTTCGGCAACTGATTAGTGCCTTTAATAATTGGCGCCCCCGACATGGCATTCCCCCGAATGAATAATATGAGCTTCTGACTTCTTCCGCCTTCTTTTCTTCTTCTATTAGCCTCTTCAGGGGTAGAAGCGGGGGCCGGAACAGGTTGAACGGTGTACCCTCCCCTTGCCGGCAACTTAGCGCACGCAGGGGCCTCTGTAGACCTCACTATTTTTTCCCTCCACCTGGCGGGGGTGTCATCAATTCTAGGCGCGATTAACTTTATTACCACTATTATTAACATAAAACCCCCATCCGTCTCACAGTACCAAACACCTCTCTTCGTGTGAGCTGTGCTTATTACTGCAGTACTTCTTCTTCTCTCTCTACCCGTTTTAGCAGCAGCAATTACAATACTGCTGACCGACCGTAATCTCAATACCACTTTTTTCGACCCTGCCGGAGGGGGTGACCCTATTTTATACCAACACTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Corythoichthys flavofasciatus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


