Overview

Comprehensive Description

Biology

Found among algal-matted rock and living corals of lagoon and seaward reefs from the low tide line to a depth of 25 m or more. Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (Ref. 33390) to the Tuamoto Islands, north to Ryukyu Islands, south to northern Australia (Ref. 33390) and the Austral Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Kenya, Madagascar, Mauritius, Red Sea, Reunion, Rodriguez, Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indian Ocean: East Africa, Comores, Madagascar, Aldabra, Amirantes, Réunion, Mauritius and Rodrigues (Mascarenes) east to Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 2636
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 120 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Neotype for Corythoichthys flavofasciatus
Catalog Number: USNM 214919
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, L. Hughes-Gannes, A. Levy, H. Harpaz & P. Raber
Year Collected: 1969
Locality: Israel, Et-Tur, Sinai Peninsula, Gulf of Suez 100 km; N of Sharm el Sheikh as road goes., Egypt, Gulf of Suez, Red Sea, Indian
Depth (m): 9
  • Neotype: Dawson, C. E. 1977. Copeia. 1977 (2): 309.; Ruppell, E. 1838. Neue Wirbelthiere zu der Fauna von Abyssinien gehorig. Fische des Rothen meeres. 4: 144.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Corythoichthys flavofasciatus
Catalog Number: USNM 51722
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Holotype: Jordan, D. S. & Starks, E. C. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 213, fig. 18.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Corythoichthys flavofasciatus
Catalog Number: USNM 337920
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Paratype: Jordan, D. S. & Starks, E. C. 1906. Bulletin of the United States Bureau of Fisheries. 25 (for 1905): 213, fig. 18.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 25 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 63 specimens in 1 taxon.
Water temperature and chemistry ranges based on 47 samples.

Environmental ranges
  Depth range (m): 0.5 - 35
  Temperature range (°C): 25.275 - 29.336
  Nitrate (umol/L): 0.047 - 0.644
  Salinity (PPS): 32.200 - 40.307
  Oxygen (ml/l): 4.427 - 4.807
  Phosphate (umol/l): 0.085 - 0.339
  Silicate (umol/l): 1.073 - 4.752

Graphical representation

Depth range (m): 0.5 - 35

Temperature range (°C): 25.275 - 29.336

Nitrate (umol/L): 0.047 - 0.644

Salinity (PPS): 32.200 - 40.307

Oxygen (ml/l): 4.427 - 4.807

Phosphate (umol/l): 0.085 - 0.339

Silicate (umol/l): 1.073 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 25m.
Recorded at 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found among algal-matted rock and living corals of lagoon and seaward reefs from the low tide line to a depth of 25 m or more (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corythoichthys flavofasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATATATAATCTTCGGTGCATGAGCCGCGATAGTGGGCACCGCCCTCAGTCTGCTGATCCGAGCAGAGCTCGGTCAACCAGGGGCACTTCTAGGTGATGACCAACTTTATAATGTAATCGTTACCGCCCACGCATTCGTAATAATCTTTTTCATAGTAATACCCATCATGATCGGCGGCTTCGGCAACTGATTAGTGCCTTTAATAATTGGCGCCCCCGACATGGCATTCCCCCGAATGAATAATATGAGCTTCTGACTTCTTCCGCCTTCTTTTCTTCTTCTATTAGCCTCTTCAGGGGTAGAAGCGGGGGCCGGAACAGGTTGAACGGTGTACCCTCCCCTTGCCGGCAACTTAGCGCACGCAGGGGCCTCTGTAGACCTCACTATTTTTTCCCTCCACCTGGCGGGGGTGTCATCAATTCTAGGCGCGATTAACTTTATTACCACTATTATTAACATAAAACCCCCATCCGTCTCACAGTACCAAACACCTCTCTTCGTGTGAGCTGTGCTTATTACTGCAGTACTTCTTCTTCTCTCTCTACCCGTTTTAGCAGCAGCAATTACAATACTGCTGACCGACCGTAATCTCAATACCACTTTTTTCGACCCTGCCGGAGGGGGTGACCCTATTTTATACCAACACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Corythoichthys flavofasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!