Overview

Comprehensive Description

Biology

Occur on the continental shelf (Ref. 75154). Found in tide pool, seagrass, and coral reef areas. Ovoviviparous (Ref. 205). The males carry the eggs in a brood pouch which is found under the tail (Ref. 205). Males may be brooding at 3.5-4.0 cm SL (Ref. 5316). Also found in lagoons and seaward reefs (Ref 90102).
  • Dawson, C.E. 1985 Indo-Pacific pipefishes (Red Sea to the Americas). The Gulf Coast Research Laboratory Ocean Springs, Mississippi, USA. (Ref. 5316)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red Sea, Western Indian Ocean: East Africa east to Amirantes and western Mascarenes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to the Society Islands, north to the Philippines and Guam, south to northern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 18 - 26; Analsoft rays: 4
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 65 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.0 cm TL (male/unsexed; (Ref. 30874))
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dark brown with parallel of small black spots in series along trunk, and some white speckles (Ref. 48635).Description: Characterized by 10 caudal rays; rings 14 - 18 + 17 - 20; continuous superior trunk and tail ridges; inferior trunk ridge ends on anal ring; lateral trunk ridge confluent with inferior tail ridge; no keels in scutella; length of snout 1.8-2.4 in head length; depth of snout 3.8-5.8 in snout length; head length 4.1-5.9 in SL (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 25 m (Ref. 30874)
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 0.25 - 30
  Temperature range (°C): 26.573 - 29.264
  Nitrate (umol/L): 0.050 - 1.161
  Salinity (PPS): 34.105 - 37.566
  Oxygen (ml/l): 4.314 - 4.744
  Phosphate (umol/l): 0.103 - 0.277
  Silicate (umol/l): 1.149 - 4.102

Graphical representation

Depth range (m): 0.25 - 30

Temperature range (°C): 26.573 - 29.264

Nitrate (umol/L): 0.050 - 1.161

Salinity (PPS): 34.105 - 37.566

Oxygen (ml/l): 4.314 - 4.744

Phosphate (umol/l): 0.103 - 0.277

Silicate (umol/l): 1.149 - 4.102
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 25m.
From 2 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Choeroichthys brachysoma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTCGGTGCTTGAGCTGGGATGGTCGGCACTGCCCTTAGTCTTTTAATTCGGACAGAGCTGAGCCAACCGGGCGCTCTATTAGGGGACGATCAAATCTACAATGTAACAGTGACTGCCCATGCATTTGTAATAATCTTCTTCATGGTCATGCCAATTATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCCGATATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTCCTACCTCCCTCCTTTCTGCTCTTATTAGCATCTGCAGCAGTAGAGGCCGGAGCAGGCACAGGATGAACAGTCTACCCCCCTCTAGCAGGAAACCTGGCTCACGCAGGGGCTTCAGTGGACCTAACAATTTTCTCCCTTCACCTTGCCGGAGTATCCTCAATCCTAGGGGCCATTAATTTCATTACAACTATTATTAACATAAAACCCCCAGCCATCACTCAGTATCAGACACCTTTATTCGTCTGGGCAGTTTTAATTACTGCAGTTTTACTATTATTATCTTTACCTGTACTAGCCGCCGGTATCACAATACTTCTCACAGATCGCAACCTCAACACAACTTTCTTTGACCCGGCAGGAGGGGGCGACCCTATCCTTTATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Choeroichthys brachysoma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!