Overview

Comprehensive Description

Biology

Occur on the continental shelf (Ref. 75154). Found in tide pool, seagrass, and coral reef areas. Ovoviviparous (Ref. 205). The males carry the eggs in a brood pouch which is found under the tail (Ref. 205). Males may be brooding at 3.5-4.0 cm SL (Ref. 5316).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red Sea, Western Indian Ocean: East Africa east to Amirantes and western Mascarenes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to the Society Islands, north to the Philippines and Guam, south to northern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 1826
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 65 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.0 cm TL (male/unsexed; (Ref. 30874))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dark brown with parallel of small black spots in series along trunk, and some white speckles (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 25 m (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 0.25 - 30
  Temperature range (°C): 26.573 - 29.264
  Nitrate (umol/L): 0.050 - 1.161
  Salinity (PPS): 34.105 - 37.566
  Oxygen (ml/l): 4.314 - 4.744
  Phosphate (umol/l): 0.103 - 0.277
  Silicate (umol/l): 1.149 - 4.102

Graphical representation

Depth range (m): 0.25 - 30

Temperature range (°C): 26.573 - 29.264

Nitrate (umol/L): 0.050 - 1.161

Salinity (PPS): 34.105 - 37.566

Oxygen (ml/l): 4.314 - 4.744

Phosphate (umol/l): 0.103 - 0.277

Silicate (umol/l): 1.149 - 4.102
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 25m.
From 2 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Choeroichthys brachysoma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTCGGTGCTTGAGCTGGGATGGTCGGCACTGCCCTTAGTCTTTTAATTCGGACAGAGCTGAGCCAACCGGGCGCTCTATTAGGGGACGATCAAATCTACAATGTAACAGTGACTGCCCATGCATTTGTAATAATCTTCTTCATGGTCATGCCAATTATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCCGATATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTCCTACCTCCCTCCTTTCTGCTCTTATTAGCATCTGCAGCAGTAGAGGCCGGAGCAGGCACAGGATGAACAGTCTACCCCCCTCTAGCAGGAAACCTGGCTCACGCAGGGGCTTCAGTGGACCTAACAATTTTCTCCCTTCACCTTGCCGGAGTATCCTCAATCCTAGGGGCCATTAATTTCATTACAACTATTATTAACATAAAACCCCCAGCCATCACTCAGTATCAGACACCTTTATTCGTCTGGGCAGTTTTAATTACTGCAGTTTTACTATTATTATCTTTACCTGTACTAGCCGCCGGTATCACAATACTTCTCACAGATCGCAACCTCAACACAACTTTCTTTGACCCGGCAGGAGGGGGCGACCCTATCCTTTATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Choeroichthys brachysoma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!