Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in coral-rich areas of lagoon and seaward reefs. Graze on algae, usually in groups of 20 individuals (Ref. 5503, 48637). Adults usually in small groups and sometimes schooling. Juveniles solitary and usually among corals (Ref. 48637). Its numerous, small pharyngeal teeth may have evolved in response to a shift in diet from macroalgae to filamentous algae (Ref. 33204). Form resident spawning aggregations (Ref. 27825). Monogamous (Ref. 52884). Group and pair spawning have been observed. The flesh is never poisonous (Ref. 4795).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Zebrasoma scopas is found from East Africa and Gulf of Aden to French Polynesia and the Pitcairn Islands except Marquesas, northwards to Suruga Bay, Honshu, Japan and southwards to the Abrolhos Island, Western Australia, Lord Howe Island, Norfolk Island and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa, including the Mascarene Islands (Ref. 37792) to the Tuamoto Islands, north to southern Japan, south to Lord Howe and Rapa islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Tuamotu Archipelago, north to southern Japan and Ogasawara Islands, south to Lord Howe Islands, New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 4 - 5; Dorsal soft rays (total): 23 - 25; Analspines: 3; Analsoft rays: 19 - 21
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Occurs in coral-rich areas of lagoon and seaward reefs. Graze on algae, usually in groups of 20 individuals (Ref. 5503). Group and pair spawning have been observed. The flesh is never poisonous (Ref. 4795).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dark brown (body in life with fine pale blue-green longitudinal lines following scale rows, becoming dots anteriorly on body and on head) (Ref 9808). Small juveniles have yellowish bars and more prominent yellow specks than adults.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Zebrasoma scopas inhabits coastal, lagoon, and outer reefs in coral-rich areas at depths between about 1-60 m (G. Allen pers comm.). It grazes on algal turf mainly on thallate and filamentous red and green algae (Choat et al. 2002, Choat et al. 2004). Juveniles recruit into high coral cover (Wilson et al. 2006).

Growth

It shows rapid growth for the first three to four years of life. Beyond four years, growth declines sharply; resulting in extended periods of asymptotic growth. The maximum number of annuli recorded for this species was 32 to 35 (Choat and Axe 1996). Maximum age was 33 years in the Great Barrier Reef (Choat and Robertson 2002a).

Reproduction

The sexes are separate among the acanthurids (Reeson 1983). There is a possibility of sexual dimorphism in Zebrasomas with cloacas bigger in females (Bushnell et al. 2010). This dimorphic character most probably applies to all Zebrasomas (J.H. Choat pers comm. 2010). This species was observed to form spawning aggregations. A single observation was made by Randall (1961b) in the Society Is. around 10-20 ft over coral heads at the edge of a lagoon next to a barrier reef with strong currents going out to open sea. Spawning occurred near dusk in subgroups with a tendency for diagonal spawning rushes. No colour changes were observed. It may form resident spawning aggregations (Domeier and Colin 1997). It was observed to pair spawn at Aldabra (Robertson et al. 1979). It was observed to form spawning aggregations on the Great Barrier Reef (Squire and Samoilys unpub., Randall 1961b, Russell 2001). It recruits all year round in low numbers in the central Visayas (R. Abesamis unpub. data).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 60 m (Ref. 1602), usually 1 - 60 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 136 specimens in 1 taxon.
Water temperature and chemistry ranges based on 89 samples.

Environmental ranges
  Depth range (m): 0.5 - 150
  Temperature range (°C): 25.198 - 29.336
  Nitrate (umol/L): 0.027 - 1.251
  Salinity (PPS): 32.902 - 36.142
  Oxygen (ml/l): 4.430 - 4.807
  Phosphate (umol/l): 0.055 - 0.301
  Silicate (umol/l): 0.721 - 4.752

Graphical representation

Depth range (m): 0.5 - 150

Temperature range (°C): 25.198 - 29.336

Nitrate (umol/L): 0.027 - 1.251

Salinity (PPS): 32.902 - 36.142

Oxygen (ml/l): 4.430 - 4.807

Phosphate (umol/l): 0.055 - 0.301

Silicate (umol/l): 0.721 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 60m.
From 1 to 60 meters.

Habitat: reef-associated. Twotone tang.  (Cuvier, 1829) Attains 20 cm. The juvenile of this tang is particularly handsome. Closely related to the sailfin tang, it has well developed, sail like dorsal and anal fins, especially as juveniles. Adults are dark yellowish brown with pale blue dots on head and body, with those on the body tending to form longitudinal lines, Juveniles have pale vertical lines on the body. Both phases have a distinctive white sheath to the caudal spine. This uncommon tang is found singly or in pairs and is confined to coral reefs aat depths of 1-60 metres. Juveniles are often observed near the branches of Acropora corals, which are used as a refuge when danger approaches. Feeds on Algae. Indo-Pacific south to Natal in South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in coral-rich areas of lagoon and seaward reefs. Graze on algae, usually in groups of 20 individuals (Ref. 5503, 48637). Feeds efficiently on a lower standing crop mat of more dispersed algae (Ref. 28026). Adults usually in small groups and sometimes schooling. Juveniles solitary and usually among corals (Ref. 48637). Its numerous, small pharyngeal teeth may have evolved in response to a shift in diet from macroalgae to filamentous algae (Ref. 33204).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Form resident spawning aggregations (Ref. 27825).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Zebrasoma scopas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Zebrasoma scopas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACGGCTCTGAGCCTGCTCATTCGAGCAGAACTTAGCCAGCCAGGCGCTCTTCTCGGAGACGACCAAATTTACAATGTAATCGTTACAGCACATGCATTCGTAATGATTTTCTTTATAGTTATACCAATTATGATTGGAGGGTTTGGAAACTGACTAATCCCACTGATAATCGGAGCCCCTGACATAGCATTCCCACGAATAAATAACATGAGCTTCTGACTCCTACCACCATCTTTCCTTCTCCTCCTTGCCTCCTCGGGTGTTGAAGCTGGGGCCGGTACAGGATGAACAGTTTATCCTCCGCTAGCGGGTAATTTGGCCCATGCCGGAGCATCCGTAGACTTAACTATCTTCTCCCTCCACCTCGCAGGGATTTCTTCAATTCTTGGAGCCATCAATTTCATTACAACCATCATTAACATGAAACCCCCTGCTATTTCACAGTACCAGACTCCCCTATTTGTATGGGCAGTCCTGATTACTGCTGTCTTGCTCCTTCTCTCTCTTCCGGTTCTTGCTGCCGGAATTACAATGCTCCTTACAGACCGAAACTTAAACACCACCTTCTTCGACCCTGCAGGAGGAGGAGACCCAATTCTCTACCAACATCTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Abesamis, R., Choat, J.H., McIlwain, J., Clements, K.D., Myers, R., Rocha, L.A., Nanola, C., Russell, B. & Stockwell, B.

Reviewer/s
Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Zebrasoma scopas is widespread in the Indo-Pacific region. It is common in many localities where it occurs and can be locally abundant. It is caught incidentally in subsistence fisheries and makes up a minor component of the aquarium trade. It is found in a number of marine reserves in parts of its range. There are no major threats known. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Zebrasoma scopas is a common species in coral reefs at most localities where it occurs (Randall 2001a). It was recorded as more abundant in offshore stations sampled at the Nha Trang Bay MPA and was found to be associated with encrusting corals (Nguyen and Phan 2008). It was recorded as abundant in the northern Bismarck Sea, Papua New Guinea (Allen 2009). It is common in Milne Bay Province, Papua New Guinea and in Raja Ampat, Indonesia (Allen 2003, 2003b). It is common and can be locally abundant in the Philippines (R. Abesamis, C. Nanola and B. Stockwell pers. comm. 2010). In the central Philippines mean biomass of Z. scopas was higher in marine reserves compared to areas open to fishing (Stockwell et al. 2009). It was the eighteenth most dominant species in Tutuila, Aunuu, and Taema Banks, American Samoa, contributing to 0.6% of total fish biomass and 1.4% of numerical abundance (Sabater and Tofaeono 2006).

Visual census surveys along the Iboih coast, Weh Island, Indonesia recorded fish densities of 10 individuals/750 m2 at Pantai sirkui and 7 individuals/750 m2 at Teupin Layeu (Faculty of Mathematics and Natural Science 2007). In Moorea, French Polynesia, SPOT satellite images allowed estimation of the surface area of fringing reef (1,076 ha), barrier reef (3,788 ha) and outer slop (493 ha). A total of 511,438 individuals were recorded in this area in fish visual surveys conducted from 1990-1993 (Lecchini et al. 2006).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Zebrasoma scopas is captured in subsistence fisheries, there may be some localized declines in areas where it is harvested.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Zebrasoma scopas

The brown tang, twotone or brush-tail tang (Zebrasoma scopas) is a marine reef tang in the fish family Acanthuridae. The brown tang is found throughout Oceania and is a herbivorous fish, feeding predominantly on filamentous algae. It is a highly popular fish in the aquarium trade.

Description[edit]

The brown tang is a laterally compressed, deep bodied fish with a protruding snout which grows to about 40 centimetres (16 in). The head is whitish and the body pale brown shading to a dark brownish-black near the black tail. There are faint pale green longitudinal lines starting as dots at the head end and becoming continuous and then dotted again posteriorly. The juveniles are rather paler and have yellowish bars near the anterior end. They also have relatively larger dorsal fins. The adults have a white spine on the caudal peduncle. The large, sail-like dorsal fin has 4 or 5 spines and 23 to 25 soft rays. The anal fin has 3 spines and 19 to 21 soft rays.[3][4] Brown Tang is also featured for the first time in the movie Breakfast at Tiffany's.

Distribution[edit]

The brown tang is found in the Indo-Pacific region, living at water depths of up to 60 metres (200 ft).[4] Its range extends from the coasts of East Africa to Japan, the Pitcairn Islands, Malaysia, Indonesia, Japan, Australia, Lord Howe Island and Rapa Iti. In 2008, a brown tang was observed near Fort Lauderdale, Florida, far outside its native range.[3]

Biology[edit]

The brown tang feeds mainly on filamentous algae. For this purpose it has specialised pharyngeal teeth. It is usually found on the exposed side of reefs and in coral-rich lagoons. The adults are gregarious and sometimes form schools but the juveniles are solitary and are often to be found swimming among corals.[4]

The brown tang is monogamous, though spawning has been observed both between pairs and among small groups. The male tends to be larger than the female. The fish rush up to the surface to spawn, fertilisation is external and the eggs are scattered in the water column. The larvae are planktonic for several weeks before settling and undergoing metamorphosis into juveniles.[4][5]

Use in aquaria[edit]

Brown tangs are popular fish to keep in a reef aquarium. They are smaller and less aggressive than other members of the Acanthuridae family and are more tolerant of a wide range of living conditions. They will accept various feedstuffs including meaty materials but the main part of the diet should be vegetable. They will eat the algae that tend to grow inadvertently in the tank. They are territorial so that if more than one is to be kept, they should all be introduced at the same time.[5]

References[edit]

  1. ^ Abesamis, R., Choat, J.H., McIlwain, J., Clements, K.D., Myers, R., Rocha, L.A., Nanola, C., Russell, B. & Stockwell, B. (2012). "Zebrasoma scopas". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 6 March 2014. 
  2. ^ Bailly, Nicolas (2010). "Zebrasoma scopas (Cuvier, 1829)". World Register of Marine Species. Retrieved 2012-02-28. 
  3. ^ a b Zebrasoma scopas (Cuvier, 1829): Brown tang USGS. Retrieved 2012-02-28.
  4. ^ a b c d Froese, Rainer, and Daniel Pauly, eds. (2005). Zebrasoma scopas in FishBase. May 2005 version.
  5. ^ a b Zebrasoma WetWebMedia. Retrieved 2012-02-28.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!