Overview

Comprehensive Description

Biology

Occurs in coral-rich areas of lagoon and seaward reefs. Graze on algae, usually in groups of 20 individuals (Ref. 5503, 48637). Adults usually in small groups and sometimes schooling. Juveniles solitary and usually among corals (Ref. 48637). Its numerous, small pharyngeal teeth may have evolved in response to a shift in diet from macroalgae to filamentous algae (Ref. 33204). Form resident spawning aggregations (Ref. 27825). Monogamous (Ref. 52884). Group and pair spawning have been observed. The flesh is never poisonous (Ref. 4795).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa, including the Mascarene Islands (Ref. 37792) to the Tuamoto Islands, north to southern Japan, south to Lord Howe and Rapa islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Kenya, Mauritius, Mozambique, Reunion, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Tuamotu Archipelago, north to southern Japan and Ogasawara Islands, south to Lord Howe Islands, New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 4 - 5; Dorsal soft rays (total): 23 - 25; Analspines: 3; Analsoft rays: 19 - 21
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark brown (body in life with fine pale blue-green longitudinal lines following scale rows, becoming dots anteriorly on body and on head) (Ref 9808). Small juveniles have yellowish bars and more prominent yellow specks than adults.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in coral-rich areas of lagoon and seaward reefs. Graze on algae, usually in groups of 20 individuals (Ref. 5503). Group and pair spawning have been observed. The flesh is never poisonous (Ref. 4795).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 60 m (Ref. 1602), usually 1 - 60 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 136 specimens in 1 taxon.
Water temperature and chemistry ranges based on 89 samples.

Environmental ranges
  Depth range (m): 0.5 - 150
  Temperature range (°C): 25.198 - 29.336
  Nitrate (umol/L): 0.027 - 1.251
  Salinity (PPS): 32.902 - 36.142
  Oxygen (ml/l): 4.430 - 4.807
  Phosphate (umol/l): 0.055 - 0.301
  Silicate (umol/l): 0.721 - 4.752

Graphical representation

Depth range (m): 0.5 - 150

Temperature range (°C): 25.198 - 29.336

Nitrate (umol/L): 0.027 - 1.251

Salinity (PPS): 32.902 - 36.142

Oxygen (ml/l): 4.430 - 4.807

Phosphate (umol/l): 0.055 - 0.301

Silicate (umol/l): 0.721 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 60m.
From 1 to 60 meters.

Habitat: reef-associated. Twotone tang.  (Cuvier, 1829) Attains 20 cm. The juvenile of this tang is particularly handsome. Closely related to the sailfin tang, it has well developed, sail like dorsal and anal fins, especially as juveniles. Adults are dark yellowish brown with pale blue dots on head and body, with those on the body tending to form longitudinal lines, Juveniles have pale vertical lines on the body. Both phases have a distinctive white sheath to the caudal spine. This uncommon tang is found singly or in pairs and is confined to coral reefs aat depths of 1-60 metres. Juveniles are often observed near the branches of Acropora corals, which are used as a refuge when danger approaches. Feeds on Algae. Indo-Pacific south to Natal in South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in coral-rich areas of lagoon and seaward reefs. Graze on algae, usually in groups of 20 individuals (Ref. 5503, 48637). Feeds efficiently on a lower standing crop mat of more dispersed algae (Ref. 28026). Adults usually in small groups and sometimes schooling. Juveniles solitary and usually among corals (Ref. 48637). Its numerous, small pharyngeal teeth may have evolved in response to a shift in diet from macroalgae to filamentous algae (Ref. 33204).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Form resident spawning aggregations (Ref. 27825).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Zebrasoma scopas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACGGCTCTGAGCCTGCTCATTCGAGCAGAACTTAGCCAGCCAGGCGCTCTTCTCGGAGACGACCAAATTTACAATGTAATCGTTACAGCACATGCATTCGTAATGATTTTCTTTATAGTTATACCAATTATGATTGGAGGGTTTGGAAACTGACTAATCCCACTGATAATCGGAGCCCCTGACATAGCATTCCCACGAATAAATAACATGAGCTTCTGACTCCTACCACCATCTTTCCTTCTCCTCCTTGCCTCCTCGGGTGTTGAAGCTGGGGCCGGTACAGGATGAACAGTTTATCCTCCGCTAGCGGGTAATTTGGCCCATGCCGGAGCATCCGTAGACTTAACTATCTTCTCCCTCCACCTCGCAGGGATTTCTTCAATTCTTGGAGCCATCAATTTCATTACAACCATCATTAACATGAAACCCCCTGCTATTTCACAGTACCAGACTCCCCTATTTGTATGGGCAGTCCTGATTACTGCTGTCTTGCTCCTTCTCTCTCTTCCGGTTCTTGCTGCCGGAATTACAATGCTCCTTACAGACCGAAACTTAAACACCACCTTCTTCGACCCTGCAGGAGGAGGAGACCCAATTCTCTACCAACATCTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Zebrasoma scopas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Zebrasoma scopas

The brown tang, twotone or brush-tail tang (Zebrasoma scopas) is a marine reef tang in the fish family Acanthuridae. The brown tang is found throughout Oceania and is a herbivorous fish, feeding predominantly on filamentous algae. It is a highly popular fish in the aquarium trade.

Contents

Description

The brown tang is a laterally compressed, deep bodied fish with a protruding snout which grows to about 40 centimetres (16 in). The head is whitish and the body pale brown shading to a dark brownish-black near the black tail. There are faint pale green longitudinal lines starting as dots at the head end and becoming continuous and then dotted again posteriorly. The juveniles are rather paler and have yellowish bars near the anterior end. They also have relatively larger dorsal fins. The adults have a white spine on the caudal peduncle. The large, sail-like dorsal fin has 4 or 5 spines and 23 to 25 soft rays. The anal fin has 3 spines and 19 to 21 soft rays.[2][3] Brown Tang is also featured for the first time in the movie Breakfast at Tiffany's.

Distribution

The brown tang is found in the Indo-Pacific region, living at water depths of up to 60 metres (200 ft).[3] Its range extends from the coasts of East Africa to Japan, the Pitcairn Islands, Malaysia, Indonesia, Japan, Australia, Lord Howe Island and Rapa Iti. In 2008, a brown tang was observed near Fort Lauderdale, Florida, far outside its native range.[2]

Biology

The brown tang feeds mainly on filamentous algae. For this purpose it has specialised pharyngeal teeth. It is usually found on the exposed side of reefs and in coral-rich lagoons. The adults are gregarious and sometimes form schools but the juveniles are solitary and are often to be found swimming among corals.[3]

The brown tang is monogamous, though spawning has been observed both between pairs and among small groups. The male tends to be larger than the female. The fish rush up to the surface to spawn, fertilisation is external and the eggs are scattered in the water column. The larvae are planktonic for several weeks before settling and undergoing metamorphosis into juveniles.[3][4]

Use in aquaria

Brown tangs are popular fish to keep in a reef aquarium. They are smaller and less aggressive than other members of the Acanthuridae family and are more tolerant of a wide range of living conditions. They will accept various feedstuffs including meaty materials but the main part of the diet should be vegetable. They will eat the algae that tend to grow inadvertently in the tank. They are territorial so that if more than one is to be kept, they should all be introduced at the same time.[4]

References

  1. ^ Bailly, Nicolas (2010). "Zebrasoma scopas (Cuvier, 1829)". World Register of Marine Species. Retrieved 2012-02-28. 
  2. ^ a b Zebrasoma scopas (Cuvier, 1829): Brown tang USGS. Retrieved 2012-02-28.
  3. ^ a b c d Froese, Rainer, and Daniel Pauly, eds. (2005). Zebrasoma scopas in FishBase. May 2005 version.
  4. ^ a b Zebrasoma WetWebMedia. Retrieved 2012-02-28.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!