Overview

Comprehensive Description

Biology

Inhabits virtually all coral reef zones (Ref. 1602). Benthopelagic in or near crevices and holes (Ref. 58302). Common in thickets of staghorn Acropora or in large Pocillopora heads (Ref. 1602). Feeds on small crustaceans, worms, and fishes during the night (Ref. 30874). Spine of preopercle venomous. Minimum depth reported taken from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Seychelles, Chagos Archipelago and Maldives east to Hawaiian Islands, Line Islands and Gambier Islands, north to Ryukyu Islands and Bonin-Ogasawara Islands, south to Western Australia, New Caledonia, Tonga and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Chagos Archipelago, Astove in Seychelles, and Maldives to the Hawaiian, Line, and Tuamoto Islands, north to the Ryukyu and Bonin Islands, south to Austral Islands; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Seychelles, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 14; Analspines: 4; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 4201))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body with red and white stripes of different widths; head reddish above, silvery below; faint red band from eye to angle of preopercle; spinous dorsal white, with a submarginal zone of red (Ref. 4201). Five oblique scale rows on cheek; body moderately elongated, depth 2.9-3.5 in SL; head length (HL) 2.8-3.4 in SL; snout length 3.9-4.35 in HL; interorbital width 4.15-4.5 in HL; maxillary reaching to about below front of iris, upper jaw length 2.85-3.15 in HL; premaxillary groove reaching to about a vertical at the front edge of orbit; anterior end of nasal bone rounded; 1-2 spinules at medial margin of nasal bone; small nasal fossa without spinules on its edge (except a 16.3 cm specimen from the Society Islands with 1 spinule); upper edge of suborbital bone weakly serrated, spineless laterally; short preopercular spine 1/4-1/3 orbit diameter, 6.15-7.95 in HL; 3rd-5th dorsal spine longest 1.5-1.95 in HL; extremely long 3rd anal spine 1.0-1.2 in HL (Ref. 27370).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits virtually all coral reef zones to a depth of 183 m. Common in thickets of staghorn @Acropora@ or in large @Pocillopora@ heads. Feeds on small crustaceans, worms, and fishes during the night. Spine of preopercle venomous.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 3 - 183m.
From 3 to 183 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 183 m (Ref. 1602), usually 1 - 35 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 143 specimens in 1 taxon.
Water temperature and chemistry ranges based on 141 samples.

Environmental ranges
  Depth range (m): 0.4575 - 20
  Temperature range (°C): 22.368 - 29.336
  Nitrate (umol/L): 0.019 - 1.204
  Salinity (PPS): 33.821 - 36.148
  Oxygen (ml/l): 4.436 - 5.079
  Phosphate (umol/l): 0.083 - 0.351
  Silicate (umol/l): 0.897 - 4.892

Graphical representation

Depth range (m): 0.4575 - 20

Temperature range (°C): 22.368 - 29.336

Nitrate (umol/L): 0.019 - 1.204

Salinity (PPS): 33.821 - 36.148

Oxygen (ml/l): 4.436 - 5.079

Phosphate (umol/l): 0.083 - 0.351

Silicate (umol/l): 0.897 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534). A nocturnal species (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sargocentron microstoma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCCGGAGCCCTTCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGGAACTGATTAATTCCTTTAATAATCGGAGCCCCCGATATGGCATTCCCTCGAATGAACAACATAAGCTTCTGACTTCTTCCTCCCTCATTCCTGCTTTTACTAGCCTCTTCCGGAGTTGAAGCCGGTGCCGGAACAGGATGAACGGTGTATCCACCCCTGGCAGGCAACCTAGCACACGCAGGAGCTTCTGTCGACTTAACTATTTTCTCACTTCACCTAGCAGGGATTTCCTCAATTCTAGGAGCCATTAATTTTATTACAACAATTATTAACATGAAACCCCCTGCCATCTCCCAATATCAAACACCTCTGTTTGTATGGGCTGTCCTAATTACAGCAGTACTTCTCCTTCTCTCCCTACCCGTACTCGCAGCAGGCATTACTATGCTACTAACAGACCGAAACCTGAATACAACATTCTTCGACCCGGCAGGAGGTGGAGACCCAATTCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sargocentron microstoma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!