Overview
Comprehensive Description
Biology
Inhabits virtually all coral reef zones (Ref. 1602). Benthopelagic in or near crevices and holes (Ref. 58302). Common in thickets of staghorn Acropora or in large Pocillopora heads (Ref. 1602). Feeds on small crustaceans, worms, and fishes during the night (Ref. 30874). Spine of preopercle venomous. Minimum depth reported taken from Ref. 30874.
-
Randall, J.E. 1998 Revision of the Indo-Pacific squirrelfishes (Beryciformes: Holocentridae: Holocentrinae) of the genus Sargocentron, with descriptions of four new species. Indo-Pac. Fish. (27):105 p. (Ref. 27370)
http://www.fishbase.org/references/FBRefSummary.php?id=27370&speccode=12991
Trusted
Distribution
Indo-West Pacific: Seychelles, Chagos Archipelago and Maldives east to Hawaiian Islands, Line Islands and Gambier Islands, north to Ryukyu Islands and Bonin-Ogasawara Islands, south to Western Australia, New Caledonia, Tonga and Austral Islands.
Trusted
Indo-Pacific: Chagos Archipelago, Astove in Seychelles, and Maldives to the Hawaiian, Line, and Tuamoto Islands, north to the Ryukyu and Bonin Islands, south to Austral Islands; throughout Micronesia.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Chagos, Seychelles, South Africa (country)
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Physical Description
Morphology
Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 14; Analspines: 4; Analsoft rays: 9 - 10
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
20.0 cm TL (male/unsexed; (Ref. 4201))
-
Randall, J.E. and P.C. Heemstra 1986 Holocentridae. p. 415-427. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4201)
http://www.fishbase.org/references/FBRefSummary.php?id=4201&speccode=4910
Trusted
Diagnostic Description
Body with red and white stripes of different widths; head reddish above, silvery below; faint red band from eye to angle of preopercle; spinous dorsal white, with a submarginal zone of red (Ref. 4201). Five oblique scale rows on cheek; body moderately elongated, depth 2.9-3.5 in SL; head length (HL) 2.8-3.4 in SL; snout length 3.9-4.35 in HL; interorbital width 4.15-4.5 in HL; maxillary reaching to about below front of iris, upper jaw length 2.85-3.15 in HL; premaxillary groove reaching to about a vertical at the front edge of orbit; anterior end of nasal bone rounded; 1-2 spinules at medial margin of nasal bone; small nasal fossa without spinules on its edge (except a 16.3 cm specimen from the Society Islands with 1 spinule); upper edge of suborbital bone weakly serrated, spineless laterally; short preopercular spine 1/4-1/3 orbit diameter, 6.15-7.95 in HL; 3rd-5th dorsal spine longest 1.5-1.95 in HL; extremely long 3rd anal spine 1.0-1.2 in HL (Ref. 27370).
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Description
Inhabits virtually all coral reef zones to a depth of 183 m. Common in thickets of staghorn @Acropora@ or in large @Pocillopora@ heads. Feeds on small crustaceans, worms, and fishes during the night. Spine of preopercle venomous.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Depth: 3 - 183m.
From 3 to 183 meters.
Habitat: reef-associated.
From 3 to 183 meters.
Habitat: reef-associated.
Trusted
Environment
reef-associated; marine; depth range 1 - 183 m (Ref. 1602), usually 1 - 35 m (Ref. 58302)
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
-
Mundy, B.C. 2005 Checklist of the fishes of the Hawaiian Archipelago. Bishop Museum Bulletins in Zoology. Bishop Mus. Bull. Zool. (6):1-704. (Ref. 58302)
http://www.fishbase.org/references/FBRefSummary.php?id=58302&speccode=46
Trusted
Depth range based on 143 specimens in 1 taxon.
Water temperature and chemistry ranges based on 141 samples.
Environmental ranges
Depth range (m): 0.4575 - 20
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 1.204
Salinity (PPS): 33.821 - 36.148
Oxygen (ml/l): 4.436 - 5.079
Phosphate (umol/l): 0.083 - 0.351
Silicate (umol/l): 0.897 - 4.892
Graphical representation
Depth range (m): 0.4575 - 20
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 1.204
Salinity (PPS): 33.821 - 36.148
Oxygen (ml/l): 4.436 - 5.079
Phosphate (umol/l): 0.083 - 0.351
Silicate (umol/l): 0.897 - 4.892
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 141 samples.
Environmental ranges
Depth range (m): 0.4575 - 20
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 1.204
Salinity (PPS): 33.821 - 36.148
Oxygen (ml/l): 4.436 - 5.079
Phosphate (umol/l): 0.083 - 0.351
Silicate (umol/l): 0.897 - 4.892
Graphical representation
Depth range (m): 0.4575 - 20
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 1.204
Salinity (PPS): 33.821 - 36.148
Oxygen (ml/l): 4.436 - 5.079
Phosphate (umol/l): 0.083 - 0.351
Silicate (umol/l): 0.897 - 4.892
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Inhabits coral reefs (Ref. 58534). A nocturnal species (Ref. 75154).
-
Hiatt, R.W. and D.W. Strasburg 1960 Ecological relationships of the fish fauna on coral reefs of the Marshall Islands. Ecol. Monogr. 30(1):65-127. (Ref. 275)
http://www.fishbase.org/references/FBRefSummary.php?id=275&speccode=4738
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sargocentron microstoma
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCCGGAGCCCTTCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGGAACTGATTAATTCCTTTAATAATCGGAGCCCCCGATATGGCATTCCCTCGAATGAACAACATAAGCTTCTGACTTCTTCCTCCCTCATTCCTGCTTTTACTAGCCTCTTCCGGAGTTGAAGCCGGTGCCGGAACAGGATGAACGGTGTATCCACCCCTGGCAGGCAACCTAGCACACGCAGGAGCTTCTGTCGACTTAACTATTTTCTCACTTCACCTAGCAGGGATTTCCTCAATTCTAGGAGCCATTAATTTTATTACAACAATTATTAACATGAAACCCCCTGCCATCTCCCAATATCAAACACCTCTGTTTGTATGGGCTGTCCTAATTACAGCAGTACTTCTCCTTCTCTCCCTACCCGTACTCGCAGCAGGCATTACTATGCTACTAACAGACCGAAACCTGAATACAACATTCTTCGACCCGGCAGGAGGTGGAGACCCAATTCTTTATCAACACCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Sargocentron microstoma
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 26
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 26
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
aquarium: public aquariums
-
Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
http://www.fishbase.org/references/FBRefSummary.php?id=9183&speccode=2594
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


