Physical Description

Diagnostic Description

Description

Size: large. Other details: very long pointed wings sharply bent at carpal joint; long deeply forked tail; short legs with weak partially webbed feet; bill long, slender, strong and sharply hooked. <388><391>
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 560 specimens in 6 taxa.
Water temperature and chemistry ranges based on 460 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 21.907 - 28.545
  Nitrate (umol/L): 0.038 - 5.422
  Salinity (PPS): 32.479 - 36.410
  Oxygen (ml/l): 4.493 - 5.087
  Phosphate (umol/l): 0.039 - 0.560
  Silicate (umol/l): 0.936 - 4.356

Graphical representation

Temperature range (°C): 21.907 - 28.545

Nitrate (umol/L): 0.038 - 5.422

Salinity (PPS): 32.479 - 36.410

Oxygen (ml/l): 4.493 - 5.087

Phosphate (umol/l): 0.039 - 0.560

Silicate (umol/l): 0.936 - 4.356
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Fregata (frigate birds) preys on:
Actinopterygii

Based on studies in:
Polynesia (Reef)

This list may not be complete but is based on published studies.
  • W. A. Niering, Terrestrial ecology of Kapingamarangi Atoll, Caroline Islands, Ecol. Monogr. 33(2):131-160, from p. 157 (1963).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 20
Specimens with Sequences: 20
Specimens with Barcodes: 20
Species: 3
Species With Barcodes: 3
Public Records: 18
Public Species: 3
Public BINs: 2
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Fregata sp. 2815okinawa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACCGCTGACTATTCTCAACCAACCACAAAGATATCGGCACTTTATACTTAATCTTCGGTGCATGAGCTGGTATAGTTGGAACCGCCCTCAGCCTTCTCATCCGAGCAGAGCTTGGCCAACCAGGAACCCTCCTAGGAGAT---GACCAAATCTACAACGTAATCGTTACTGCTCACGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATGATCGGAGGATTTGGAAACTGACTTCTCCCACTTATAATTGGCGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCACCATCCTTCCTACTCCTACTAGCCTCTTCTACCGTCGAAGCAGGAGCAGGCACAGGGTGAACCGTATACCCCCCACTAGCTGGTAACCTAGCCCATGCTGGAGCATCCGTAGACCTCGCCATCTTCTCTCTTCACCTAGCAGGTGTCTCCTCTATTCTAGGAGCAATCAACTTCATCACAACTGCCACTAATATAAAACCTCCTGCTCTCTCACAATACCAAACACCCCTATTCGTATGATCCGTCCTCATCACTGCTGTCCTACTCCTACTCTCACTCCCAGTCCTCGCTGCCGGCATCACCATACTACTAACAGACCGAAACCTAAATACCACATTCTTTGACCCGGCCGGAGGAGGAGACCCAGTACTGTACCAACACCTTTTCTGATTCTTCGGCCACCCTGAAGTCTACATTCTAATTCTCCCAGGCTTCGGTATAATCTCGCATGTAGTAACATACTATGCAGGAAAAAAAGAACCCTTCGGCTACATAGGAATAGTATGAGCTATACTATCCATCGGATTCCTAGGCTTCATCGTATGAGCTCATCACATATTCACAGTAGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fregata sp. 2815okinawa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Frigatebird

For the nuclear test codenamed Frigate Bird, see Operation Dominic I and II.

The frigatebirds are a family, Fregatidae, of seabirds. There are five species in the single genus Fregata. They are also sometimes called man of war birds or pirate birds. Since they are related to the pelicans, the term "frigate pelican" is also a name applied to them. They have long wings, tails, and bills and the males have a red gular pouch that is inflated during the breeding season to attract a mate.

Frigatebirds are pelagic piscivores that obtain most of their food on the wing. A small amount of their diet is obtained by robbing other seabirds, a behaviour that has given the family its name, and by snatching seabird chicks. Frigatebirds are seasonally monogamous, and nest colonially. A rough nest is constructed in low trees or on the ground on remote islands. A single egg[1] is laid each breeding season. The duration of parental care in frigatebirds is among the longest for birds, rivalled only by the southern ground hornbill and some large accipitrids.[2]

Biology[edit]

Morphology[edit]

Frigatebirds are large, with iridescent black feathers (the females have a white underbelly), with long wings (male wingspan can reach 2.3 metres (7.5 ft)) and deeply forked tails. The males have inflatable red-coloured throat pouches called gular pouches, which they inflate to attract females during the mating season.

Frigatebirds are found over tropical oceans and ride warm updrafts. Therefore, they can often be spotted riding weather fronts and can signal changing weather patterns.

These birds do not swim and cannot walk well, and cannot take off from a flat surface. Having the largest wingspan to body weight ratio of any bird, they are essentially aerial, able to stay aloft for more than a week, landing only to roost or breed on trees or cliffs.

As members of Pelecaniformes, frigatebirds have the key characteristics of all four toes being connected by the web, a gular sac (also called gular skin), and a furcula that is fused to the breastbone. Although there is definitely a web on the frigatebird foot, the webbing is reduced and part of each toe is free. Frigatebirds produce very little oil and therefore do not land in the ocean. The gular sac is used as part of a courtship display and is, perhaps, the most striking frigatebird feature.

Male magnificent frigatebird in the Galapagos Islands

Breeding behavior[edit]

They generally lay one white egg per clutch.[1] Both parents take turns feeding for the first three months but then only the mother feeds the young for another eight months. It takes so long to rear a chick that frigatebirds cannot breed every year. It is typical to see juveniles as big as their parents waiting to be fed. When they sit waiting for endless hours in the hot sun, they assume an energy-efficient posture in which their head hangs down, and they sit so still that they seem dead. But when the parent returns, they will wake up, bob their head, and scream until the parent opens its mouth. The hungry juvenile plunges its head down the parent's throat and feeds at last.

Distribution and identifying characteristics differ among frigatebird species, and thus are addressed in species-specific articles.

Feeding[edit]

Frigatebirds obtain most of their food by snatching it from the ocean surface. In this case an immature great frigatebird is snatching a sooty tern chick dropped by another frigatebird

Frigatebirds' feeding habits are pelagic. Lacking the ability to take off from water, they snatch prey from the ocean surface or beach using their long, hooked bills. They catch fish, baby turtles, the marine iguana, and similar items in this way. Frigatebirds will rob other seabirds such as boobies, tropicbirds, and shearwaters of their catch, using their speed and manoeuvrability to outrun and harass their victims until they regurgitate their stomach contents. Although frigatebirds are renowned for their kleptoparasitic feeding behaviour, kleptoparasitism is not thought to play a significant part of the diet of any species, and is instead a supplement to food obtained by hunting.[3] A study of great frigatebirds stealing from masked boobies estimated that the frigatebirds could at most obtain 40% of the food they needed, and on average obtained only 5%.[4]

Species[edit]

Frigatebird hunting[edit]

In Nauru, catching frigatebirds was an important tradition. It is still practised to a lesser degree. Donald W. Buden writes: "Birds typically are captured by slinging the weighted end of a coil of line in front of an approaching bird attracted to previously captured birds used as decoys. In a successful toss, the line becomes entangled about the bird’s wing and bringing [sic] it to ground."[5]

See also[edit]

Notes[edit]

  1. ^ a b HOWARD, Laura. University of Michigan Museum of Zoology – ADW : Family Fregatidae
  2. ^ See Skutch; Alexander Frank (author) and Gardner, Dana (illustrator) Helpers at birds' nests : a worldwide survey of cooperative breeding and related behavior; pp. 69–71. Published 1987 by University of Iowa Press. ISBN 0877451508
  3. ^ Schreiber, Elizabeth A. & Burger, Joanne.(2001.) Biology of Marine Birds, Boca Raton:CRC Press, ISBN 0-8493-9882-7
  4. ^ Vickery, J & Brooke, M. (1994) "The Kleptoparasitic Interactions between Great Frigatebirds and Masked Boobies on Henderson Island, South Pacific " Condor 96: 331–340
  5. ^ Donald W. Buden, "The Birds of Nauru", Notornis, 2008, Vol. 55: pp 8–19

References[edit]

  • Harrison, Peter (1988). Seabirds: An Identification Guide. London: Christopher Helm. ISBN 0-7470-1410-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!