Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Forms aggregations among the branches of Porites nigrescens and P. cylindrica in sheltered bays and lagoons (Ref. 1602, 48635). Disperses at night to feed close to the bottom (Ref. 9710). Has been reared in captivity (Ref. 35407). Popular aquarium fish (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Java to Fiji, north to the Ryukyu Islands, south to the Great Barrier Reef. Recently recorded from Tonga (Ref. 53797).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7 - 8; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.5 cm TL (male/unsexed; (Ref. 48635))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinctive species with tail fins and brightly colored red eyes. Broad black central body band and head yellow (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 14 m (Ref. 11890)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 1 - 17
  Temperature range (°C): 28.409 - 28.851
  Nitrate (umol/L): 0.059 - 0.617
  Salinity (PPS): 32.848 - 34.235
  Oxygen (ml/l): 4.279 - 4.551
  Phosphate (umol/l): 0.088 - 0.332
  Silicate (umol/l): 1.436 - 2.712

Graphical representation

Depth range (m): 1 - 17

Temperature range (°C): 28.409 - 28.851

Nitrate (umol/L): 0.059 - 0.617

Salinity (PPS): 32.848 - 34.235

Oxygen (ml/l): 4.279 - 4.551

Phosphate (umol/l): 0.088 - 0.332

Silicate (umol/l): 1.436 - 2.712
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 14m.
From 1 to 14 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154); lives among branching corals (Ref. 9137). Disperses at night to feed close to the bottom (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Are mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphaeramia nematoptera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGGGCCGGGATAGTCGGAACAGCCCTTAGCCTGCTCATTCGAGCGGAGCTAAGCCAGCCTGGGGCCCTTCTCGGCGACGACCAGATTTACAACGTAATCGTAACAGCACATGCATTTGTTATAATCTTCTTTATAGTAATGCCAATTATGATTGGGGGCTTTGGGAACTGACTAATTCCACTAATAATCGGTGCCCCCGATATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTCCTTCCACCCTCATTTCTCCTCCTCCTTGCCTCCTCAGGGGTAGAAGCTGGGGCCGGGACCGGGTGAACCGTTTACCCGCCTCTCGCGGGCAATCTTGCACACGCGGGGGCTTCCGTTGACCTAACAATTTTCTCCCTGCACCTCGCAGGTATCTCATCAATTCTGGGAGCCATCAACTTCATTACCACAATTATTAATATGAAACCCCCTGCAATCACTCAGTATCAAACTCCTCTATTTGTGTGAGCAGTCCTTATTACTGCTGTCCTCCTTCTTCTCTCCCTCCCTGTTCTAGCTGCTGGTATCACCATGCTACTGACAGACCGGAACTTAAACACAACCTTCTTCGACCCGGCCGGAGGAGGAGACCCAATCCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sphaeramia nematoptera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!