Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in seaward reefs among coral branches. Also in clear coastal waters, dense coral habitats on shallow reef crest or slopes to depth of about 20 m. Usually occurs in small loose groups. A shy species, usually swimming amongst the protection of coral branches (Ref. 48636). Feeds mainly on small crustaceans (Ref. 1602). Secretive (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-West Pacific Ocean from the Red Sea to South Africa, to Ryukyu Islands (Japan), Johnston Island, Australia, Lord Howe and Tuamotu Islands, but not in the Hawaiian Islands (Parenti and Randall 2000).

It is found in Kimbe Bay (Papua New Guine) (Hubble 2003), Shark Reef, Beqa Lagoon, (Fiji), Mozambique (Pereira 2000), Solomon Islands (Allen 2006), at Guadalcanal (Blaber et al. 1991), Reunion Island (Letourneur et al. 2004) and the Jordanian Red Sea (Khalaf and Kchhzius 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea south to Natal, South Africa (Ref. 4392) and east to the Tuamoto Islands, north to the Ryukyu Islands, south to Lord Howe and the Austral islands. Distribution includes St. Brandon's Shoals and Gulf of Tadjoura (Ref. 33410).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 4392))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in seaward reefs among coral branches. Feeds mainly on small crustaceans.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Identified by the brightly color lined pattern and the small ocellus on the caudal fin base (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in seaward reefs among coral branches. It also occurs in clear coastal waters, dense coral habitats on shallow reef crest or slopes to a depth of about 20 m. It inhabits depths from 3-30 m (Brunnschweiler and Earle 2006). It usually occurs in small loose groups.

This species is identified by the brightly colored line pattern and the small ocellus on the caudal fin base (Kuiter and Tonozuka 2001). It is a shy species, usually swimming amongst the protection of coral branches (Kuiter and Tonozuka 2001). It is commonly associated to Pocillopora (Hubble 2003). It feeds mainly on small crustaceans (Myers 1991). It is a secretive species (Myers 1999).

It is known to spawn just before sunset at Miyake-jima (Izu Islands), the upward spawning dash very short and rapid, to reduce predation risk upon spawning adults by crepuscular carnivores (Kuwamura 1981).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 35 m (Ref. 1602), usually 4 - 35 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 278 specimens in 1 taxon.
Water temperature and chemistry ranges based on 171 samples.

Environmental ranges
  Depth range (m): 0.5 - 80
  Temperature range (°C): 24.353 - 29.336
  Nitrate (umol/L): 0.019 - 1.251
  Salinity (PPS): 32.200 - 38.279
  Oxygen (ml/l): 3.755 - 4.814
  Phosphate (umol/l): 0.055 - 0.351
  Silicate (umol/l): 0.803 - 5.551

Graphical representation

Depth range (m): 0.5 - 80

Temperature range (°C): 24.353 - 29.336

Nitrate (umol/L): 0.019 - 1.251

Salinity (PPS): 32.200 - 38.279

Oxygen (ml/l): 3.755 - 4.814

Phosphate (umol/l): 0.055 - 0.351

Silicate (umol/l): 0.803 - 5.551
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 35m.
From 2 to 35 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in seaward reefs among coral branches. Feeds mainly on small crustaceans (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocheilinus hexataenia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATATTTAGTGTTTGGTGCTTGAGCTGGAATGGTGGGGACAGCCCTAAGCTTACTCATCCGAGCGGAACTCAGCCAACCAGGGGCTCTCCTGGGCGATGATCAGATTTATAACGTAATTGTTACTGCACATGCTTTCGTAATAATCTTTTTTATGGTCATGCCAATCATGATTGGAGGGTTCGGAAACTGACTAATCCCCTTAATGATCGGGGCCCCCGACATGGCATTCCCCCGAATGAATAACATGAGCTTCTGACTTCTCCCTCCTTCCTTCCTGCTCCTCTTAGCCTCATCAGGCGTCGAAGCCGGGGCCGGAACGGGCTGAACTGTTTACCCGCCTCTAGCTGGCAACCTTGCACACGCAGGGGCCTCTGTTGATCTAACAATTTTCTCTCTCCACCTTGCAGGGATTTCTTCTATTCTGGGGGCCATCAACTTTATCACAACAATTATTAACATGAAACCCCCCGCTATCTCCCAGTATCAAACCCCACTATTCGTCTGGGCAGTCCTGATTACGGCTGTTCTTCTACTCCTTTCTCTCCCAGTCCTAGCTGCCGGCATTACAATGCTTCTGACGGACCGAAATCTTAACACGACTTTCTTTGACCCTGCGGGAGGGGGGGATCCGATCCTTTACCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocheilinus hexataenia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at State Herbarium of South Australia
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Bertoncini, A.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This is a very widespread species and is common throughout most of its range.This species is targeted and is very popular in the ornamental aquarium fish trade, however this is not thought to be a threat. It is found in a number of marine protected areas in parts of its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
For the Solomon Islands Marine Assessment (Allen 2006) it was considered moderately common at depths from 2-35 m, but only a few were seen on each dive. This species displayed cryptic habits. It was occasionally seen at Pulau Tioman Marine Park, Tioman Island, Malaysia (Yusuf et al. 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known to this species, although it is targeted and very popular in the ornamental aquarium fish trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range (Wood 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pseudocheilinus hexataenia

The six-line wrasse, Pseudocheilinus hexataenia, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. This species inhabits coral reefs at depths from 1 to 35 m (3.3 to 115 ft). It can reach 10 cm (3.9 in) in total length. It can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Bertoncini, A. 2010. Pseudocheilinus hexataenia. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 15 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Pseudocheilinus hexataenia" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!