Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit lagoon and coastal reefs, in areas with mixed sand, rubble, and coral (Ref. 9710). Occasionally in grassy areas. Feed mainly on benthic invertebrates such as mollusks and crustaceans. Oviparous, distinct pairing during breeding (Ref. 205).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-Pacific from East Africa to the Marquesan and Tuamoto islands, north to the Ryukyu Islands, south to New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Marquesan and Tuamoto islands, north to the Ryukyu Islands, south to New Caledonia and Rapa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles and Mascarenes east to Wake Atoll, Marquesas Islands and Gambier Islands, north to southern Japan, south to Western Australia, Queensland (Australia), Elizabeth and Middleton reefs, New Caledonia an
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 8 - 9; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 450 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

45.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs on coral reefs and occasionally in grassy areas. Feeds mainly on benthic invertebrates such as molluscs and crustaceans.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The only Cheilinus that has 10 dorsal spines. Exhibits a coloration very similar to C. trilobatus, but has black and white specks on its pelvic, anal and caudal fins, while C. trilobatus has vertical red, white and black streaks on its body scales. Large adults of both species have numerous red spots and streaks on the head and trilobed caudal fins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in coral reefs, coastal reefs and in areas with mixed sand, rubble and corals, individuals are also recorded occasionally in sea grass areas (Allen 2000) at depths of two to at least 30 m (Myers 1991). Coastal reefs and sand lagoons inside outer reef areas (Kuiter 2006).

Coloration of this species is similar to C. trilobatus (Myers 1991) and colours are variable in intensity but always include black and white specks on body and white specks on pelvic, anal and caudal fins. Caudal fin of adult males have upper and lower rays prolonged as filaments, conversely, fin rounded in females (Sadovy and Cornish 2000).

Juveniles of this species are protected by living in live branching corals, such as ,i>Labrichthys unilineatus and so might explain the generally low mortality (Eckert 1987).

At One Tree Lagoon, the Great Barrier Reef, overall mortality during first year for C. chlorourus was 25%, average annual mortality was 20.5 +/- 4.1 % (Eckert 1987).

It feeds mainly on benthic invertebrates including molluscs, crustaceans, polychaetes and sea urchin (Froese and Pauly 2008).


Maximum size of the species is 45 cm TL (Lieske and Myers 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 9823)
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 83 specimens in 1 taxon.
Water temperature and chemistry ranges based on 50 samples.

Environmental ranges
  Depth range (m): 0.4575 - 150
  Temperature range (°C): 25.709 - 29.171
  Nitrate (umol/L): 0.047 - 0.622
  Salinity (PPS): 32.200 - 36.142
  Oxygen (ml/l): 4.290 - 4.748
  Phosphate (umol/l): 0.055 - 0.339
  Silicate (umol/l): 1.043 - 4.752

Graphical representation

Depth range (m): 0.4575 - 150

Temperature range (°C): 25.709 - 29.171

Nitrate (umol/L): 0.047 - 0.622

Salinity (PPS): 32.200 - 36.142

Oxygen (ml/l): 4.290 - 4.748

Phosphate (umol/l): 0.055 - 0.339

Silicate (umol/l): 1.043 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits lagoon and coastal reefs, in areas with mixed sand, rubble, and coral (Ref. 9710). Occasionally in grassy areas. Feeds mainly on benthic invertebrates such as molluscs and crustaceans.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cheilinus chlorourus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCCTGAGCTGGGATAGTAGGTACTGCCCTTAGCCTACTCATCCGAGCGGAACTTAGCCAACCAGGCGCTCTTCTTGGAGACGACCAGATCTATAATGTAATCGTAACAGCCCATGCTTTCGTTATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGGCTAATCCCCCTTATGATCGGCGCTCCCGACATGGCCTTTCCTCGTATGAACAATATGAGCTTTTGACTCCTTCCTCCCTCTTTCCTCCTTCTTCTTGCATCCTCTGGCGTAGAAGCAGGGGCTGGTACGGGCTGAACAGTTTACCCCCCACTAGCCGGAAATTTGGCCCATGCAGGTGCATCCGTAGATTTAACAATCTTCTCCCTTCACCTAGCCGGGATCTCATCAATTTTAGGGGCCATTAACTTCATCACCACTATTATTAACATGAAACCCCCAGCCATCACTCAATACCAAACCCCCCTATTCGTCTGAGCAGTCCTCATTACAGCCGTTCTTCTACTACTTTCACTCCCCGTCCTCGCCGCGGGCATCACAATGCTTCTCACGGACCGAAACCTAAACACAACCTTCTTCGATCCGGCAGGAGGGGGAGACCCAATTCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cheilinus chlorourus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Florida Museum of Natural History
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Shea, S., Liu, M. & Sadovy, Y.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and is common in many parts of its range. There are no major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common in much of its range, and can be locally abundant.

In Solomon Islands, this species is rare (Allen 2006).

In Micronesia, this species is moderately common in areas of mixed sand, rubble and coral of lagoon reefs at depths of two to at least 30 m (Myers 1991).

In Hong Kong, abundance variable but exists in reasonable numbers in some shallow coral areas and less abundant in areas of boulders (Sadovy and Cornish 2000).

One to 25 individuals of C. chlorourus have been observed during visual surveys in 1998 and 2000 at Dampier Archipelago, Western Australia (Hutchins 2004).

2.306 +/- 0.156 individuals per 100 m2 of C. chlorourus which accounting 9.8 % of the total percentage of the density of all piscivores of the western side of Lizard Island (14°40’S, 145°28’E) have been noted in Stewart and Jones (2001).

Fourty-one individuals were observed in the lagoon areas in Rodrigues, Mauritius (Hardman et al., 2008) and C. chlorourus is listed as common fish species in Taiaro Atoll (Tuamotu Archipelago, French Polynesia) (Galzin et al. 1998).

In Fiji, a total of 1,286 individuals were observed in various UVC surveys with body sizes of 50-300 mm TL (M. Kulbicki pers. comm. 2008).

In New Caledonia, a total of 3,644 individuals were observed in various UVC surveys with body sizes of 30-400 mm TL. In 29 stations, a total of 68 individuals were caught with total body weight of 2,203 g (M. Kulbicki pers. comm. 2008).

In French Polynesia, a total of 1785 individuals were observed in various UVC surveys with body sizes of 30-300 mm TL (M. Kulbicki pers. comm. 2008).

In Tonga, a total of 1,084 individuals were observed in various UVC surveys with body sizes of 40-300 mm TL (M. Kulbicki pers. comm. 2008).

On the east coast of Peninsular Malaysia, an estimated mean density of 2.3 individuals from twenty 50 m X 5 m transects was recorded in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species. However, it is caught incidentally in the live reef fish food trade in some parts of its range, and is also collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for this species. However, this species distribution includes a number of Marine Protected Areas within its range.

In New Caledonia, individuals were found in permanent marine reserves of Southwest lagoon of New Caledonia (Wantiez et al. 1997).

Cheilinus chlorourus was observed in the Tung Ping Chau Marine Park and Cape d’ Aguilar Marine Reserve, Hong Kong (Cornish 2000).

In Western Australia, several small no-take zones, Surf Point, Mary Anne Island, and Sandy Point are likely to encompass habitat occupied by C. chlorourus. There are totally eight no-take zones within the Ningaloo Reef Marine Park, spear-fishing is prohibited throughout the marine park and proposals are currently being considered for new marine parks in the Dampier Archipelago (Penn 2002) where C. chlorourus was observed (Hutchins 2004). It is worth noting that marine parks in western Australia do not necessarily imply no-take zones, but may include no-take zones within their boundaries or restrictions on catch limits or methods used for fishing. In Queensland, there is a minimum legal catch size for wrasses of 25 cm and daily catch limit of five fish per angler (Department of Primary Industries and Fisheries 2003).

In the south coast region of Western Australia, there is no minimum legal catch size for wrasse (Labridae), however the daily bag limit for the wrasse is eight fish per angler (Government of Western Australia 2008) and spear-fishing for wrasse (Labridae) is restricted in all marine park waters (Government of Western Australia 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cheilinus chlorourus

The floral wrasse, Cheilinus chlorourus, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean from the coast of Africa to the Tuamotus and Marquesas. Its range extends as far north as the Ryukyus and south to New Caledonia. It is an inhabitant of reefs in lagoons or coastal waters at depths of from 1 to 30 m (3.3 to 98 ft). This species can reach 45 cm (18 in) in total length. It is of minor importance to local commercial fisheries and can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Shea, S., Liu, M. & Sadovy, Y. 2010. Cheilinus chlorourus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 11 September 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cheilinus chlorourus" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!