Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Longnose Butterflyfish (Forcipiger longirostris) are bright yellow, with the upper half of the head and nape black and the lower half white. There is a black spot on the anal fin, just below the base of the caudal fin. They have a very long snout and a mouth with almost no gape. Length may reach 22 cm. The only other Forcipiger species, the generally more common Forcepsfish (Forcipiger flavissimus), is very similar in color to the Longnose Butterflyfish (with which it was long confused; see Randall and Caldwell 1970), but Forcepsfish have a distinctly shorter snout, have a mouth with a distinct gape (hence forceps-like), and lack the blackish dots that are present on the chest of Longnose Butterflyfish. Some Longnose individuals are entirely dark brown. Longnose Butterflyfish occur from East Africa to Polynesia; Forcepsfish occur from East Africa to Central America and Mexico. (Randall et al. 1997)

Several other species of butterflyfishes (family Chaetodontidae) have elongate jaws and feed on a wide range of predominantly attached, benthic invertebrate prey and some free-living, mobile prey. It is thought that the ‘‘manipulation’’ method is used by butterflyfishes to grip and remove pieces from polychaetes, nemerteans, corals, ascidians, echinoids, hydroids, and other attached prey. Suction feeding is thought to be used when preying upon mobile prey such as calanoid copepods, amphipods, and crab larvae, which are ingested intact. In contrast to other chaetodontids studied, detailed observations in Hawaii and Moorea suggest that the Longnose Butterflyfish, the longest-jawed of the butterflyfishes, is a specialized predator of mobile decapod shrimps, particularly the elusive caridians that live within coral reefs. All five butterfly species studied by Ferry-Graham et al. (2001a) utilized a combination of suction and ram when feeding on brine shrimp in the lab, but Longnose Butterflyfish exhibited a ram contribution to the strike that was more than twice that seen in any of the other species, permitting this species to initiate strikes from the greatest initial predator-prey distance. Longnose Buterflyfish are known to possess a major structural novelty in the feeding mechanism that permits anterior movement of the entire jaw apparatus. The ability to feed successfully on elusive prey appears to be related to exceptional jaw protrusion, resulting in greater use of ram during prey capture. This ability to protrude long, slender jaws toward the prey may allow a Longnose Butterflyfish to move its jaws without detection close enough to a potential prey item to permit the effective use of suction. Interestingly, of 18 butterflyfish species examined in Moorea (French Polynesia), the congeners F. flavissimus and F. longirostris exhibited the broadest and narrowest diets, respectively. (Ferry-Graham et al. 2001a,b and references therein)

Boyle and Tricas (2011) studied the kinematics of sound production in both Forcipiger species and suggested that correlations within both species between aspects of acoustic signals and size and condition variables that may be related to resource holding potential during social encounters could allow Forcipiger sounds to function as “honest” social signals.

  • Boyle, K.S. and T.C. Tricas. 2011. Sound production in the longnose butterflyfishes (genus Forcipiger): cranial kinematics, muscle activity and honest signals. J Exper Biol 214: 3829-3842.
  • Ferry-Graham, L.A., Wainwright, P.C., and D.R. Bellwood. 2001a. Prey capture in long-jawed butterflyfishes (Chaetodontidae): the functional basis of novel feeding habits. Journal of Experimental Marine Biology and Ecology 256: 167–184.
  • Ferry-Graham, L.A., Wainwright, P.C., Hulsey,C.D., and D.R. Bellwood. 2001b. Evolution and Mechanics of Long Jaws in Butterflyfishes (Family Chaetodontidae). Journal of Morphology 248:120–143.
  • Randall, J.E. and D.K. Caldwell. 1970. Clarification of the Species of the Butterflyfish Genus Forcipiger. Copeia (4): 727-731.
  • Randall, J.E., Allen, G.R., and R.C. Steene. Fishes of the Great Barrier Reef and Coral Sea, 2nd edition. 1997. University of Hawaii Press, Honolulu.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

A generally uncommon species that inhabits seaward reefs to depths greater than 60 m (Ref. 9710). Benthopelagic (Ref. 58302). Feeds mainly on whole organisms such as small crustaceans. Usually seen in pairs. Oviparous (Ref. 205), monogamous (Ref. 52884). Forms pairs during breeding (Ref. 205). Sometimes dark brown instead of yellow (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread throughout the Indo-Pacific, from Socotra to Mozambique in East Africa, to the Hawaiian Islands and Pitcairn group north to the Ryukyu and Ogasawara Islands, south to New Caledonia and the Austral Islands. This species has a depth range of 2-208 m. Range size ~74 million km2, from values estimated by Jones et al. (2002) based on projection of distribution maps from Allen et al. (1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Hawaiian, Marquesan, and Pitcairn islands, north to the Bonin [=Ogasawara] Islands, south to New Caledonia and the Austral Islands; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Comores and western Mascarenes east to Hawaiian Islands and Pitcairn Group, north to Ogasawara Islands, south to Western Australia, Queensland (Australia), New Caledonia, and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 11; Dorsal soft rays (total): 24 - 28; Analspines: 3; Analsoft rays: 17 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 220 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

22.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits seaward reefs from 5 to at least 60 m in depth. Feeds mainly on whole organisms such as small crustaceans.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Snout extremely long (Ref. 48636). Rare uniformly black color phase.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Forcipiger cyrano
Catalog Number: USNM 181374
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Year Collected: 1909
Locality: Buka Buka Island, North; Gulf of Tomini, Celebes, Buka Buka Island, Indonesia, Suluwesi Islands, Gulf of Tomini, Pacific
Depth (m): 2 to 5
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Forcipiger cyrano
Catalog Number: USNM 169774
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): W. Chapman
Year Collected: 1944
Locality: Solomons: New Georgia; outer reef Wana-Wana Island, Blackett Strait., New Georgia Islands, Solomon Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Forcipiger cyrano
Catalog Number: USNM 181373
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Year Collected: 1909
Locality: W. of Malibogu Pt. (Celebes), Gulf of Tomini., Sulawesi, Indonesia, Pacific
Depth (m): 3 to 6
Vessel: Albatross
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in outer reef areas, often in the vicinity of drop-offs. Usually occurs alone or in pairs. The diet composed mostly of small invertebrates (G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 3 - 70 m (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 9 - 58
  Temperature range (°C): 26.287 - 28.876
  Nitrate (umol/L): 0.055 - 1.486
  Salinity (PPS): 34.228 - 35.069
  Oxygen (ml/l): 4.421 - 4.721
  Phosphate (umol/l): 0.130 - 0.233
  Silicate (umol/l): 1.214 - 4.407

Graphical representation

Depth range (m): 9 - 58

Temperature range (°C): 26.287 - 28.876

Nitrate (umol/L): 0.055 - 1.486

Salinity (PPS): 34.228 - 35.069

Oxygen (ml/l): 4.421 - 4.721

Phosphate (umol/l): 0.130 - 0.233

Silicate (umol/l): 1.214 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 70m.
From 3 to 70 meters.

Habitat: reef-associated. Longnose butterflyfish.  (Broussonet, 1782) Attains 22cm. Snout longer than in flavissimus (1.1 to 1.5) of body length. East Africa to Polynesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A generally uncommon species that inhabits seaward reefs to depths greater than 60 m (Ref. 9710). Feeds mainly on whole organisms such as small crustaceans. Uses its elongated snout to probe reef crevices for small shrimps that are secreted there (Ref. 59308).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Forcipiger longirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTCGGTGCTTGAGCAGGAATAGTAGGCACAGCTCTTAGCCTACTCATCCGAGCAGAACTTAATCAGCCGGGCTCCCTTCTGGGGGACGACCAGATTTACAATGTTATCGTCACAGCTCATGCGTTTGTGATAATTTTCTTTATAGTAATACCTATCATGATTGGAGGGTTCGGGAACTGACTAATCCCTCTAATAATCGGAGCCCCCGACATGGCCTTCCCTCGAATAAACAACATAAGTTTCTGATTACTTCCCCCTTCCTTCTTCCTTCTCCTCGCCTCCTCTGGCGTAGAAGCTGGGGCTGGTACCGGATGAACTGTCTACCCACCGCTCGCTGGTAACCTCGCCCATGCAGGGGCCTCTGTTGACTTAACTATCTTCTCCCTCCACTTAGCAGGGGTCTCTTCAATTCTGGGGGCCATTAATTTTATTACTACTATTATCAATATAAAACCCCCAGCTATGACCCAATATCAAACCCCTCTCTTCGTATGATCGGTTCTAATTACCGCCGTCCTACTCCTCCTATCCCTCCCTGTTCTTGCCGCCGGAATTACAATGCTACTAACAGACCGAAACCTAAATACAACCTTCTTTGACCCGGCAGGAGGCGGTGACCCTATCCTTTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Forcipiger longirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
This species has exhibited localised declines in abundance at Moorea (French Polynesia), but it is unclear whether this is linked to coral loss. It is listed as Least Concern in view of its wide range. Research is required to establish whether there is a reliance on live coral (perhaps during settlement).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is generally uncommon (G.R. Allen pers. comm. 2006). Declines in its abundance (50% decline) were documented following coral loss at Moorea (French Polynesia) in 1980, and there has been no recovery to 2003 (Berumen and Pratchett 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species was observed to decline in abundance following coral depletion at Moorea (French Polynesia) but it is unknown why this species would be sensitive to coral loss. There are currently no other threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place. This species is present within marine protected areas. Monitoring of this species is needed in conjunction with coral monitoring, as well as determination of the degree of co-dependence between this species and corals. Research is required to establish whether it is reliant on live coral.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Forcipiger longirostris

Forcipiger longirostris, commonly known as the longnose butterflyfish or big longnose butterflyfish,[2] is a species of butterflyfish found on coral reefs throughout the tropical waters of the Indo-Pacific.[3] Even with its distinctive, point-like long nose, the longnose butterflyfish still can easily be confused with its more common cousin F. flavissimus. Both species may be kept in aquariums.

Description[edit]

F. longirostris has a compressed yellow body with a black triangular region on its head, and as the name implies, a long, silvery snout. Usually 10 or 11 dorsal spines, a black spot on the anal fin, and rows of small black spots on the breast are found. The fish grows to about 22 cm (8.7 in) in length. In comparison, F. flavissimus has more dorsal spines, lacks the black spots, and its operculum is more curved.[4]

Rarely, F. longirostris can be found in an all-black form, as well,[5] or the yellow portion may be brown.[6]

Behavior[edit]

F. longirostris is a diurnal omnivore,[7] feeding mostly on small crustaceans, tube feet of echinoderms and sea urchins, and polychaete tentacles. Like other butterflyfish species, longnose butterflyfish mate for life.

Nomenclature[edit]

F. longirostris, together with F. flavissimus, is known for having the longest fish name in the Hawaiian language: lauwiliwilinukunukuʻoiʻoi,[8] or "long-snouted (sharp-beaked) fish shaped like a wiliwili leaf". It was the first Hawaiian fish to receive a scientific name, when Captain James Cook collected a specimen (this remains part of the British Museum collection).[5]

References[edit]

  1. ^ Myers, R. & Pratchett, M. 2010. Forcipiger longirostris. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 21 October 2013.
  2. ^ http://www.fishbase.org/comnames/CommonNamesList.php?ID=5585&GenusName=Forcipiger&SpeciesName=longirostris&StockCode=5875
  3. ^ Lieske & Myers,Coral reef fishes,Princeton University Press, 2009, ISBN 9780691089959
  4. ^ "Longnose Butterflyfish". Australian Museum. November 2004. Retrieved 2009-04-20. 
  5. ^ a b "02 Year - Final Report" (PDF). University of Hawaii Cooperative National Park Resources Studies Unit. November 10, 1975. pp. 49–50. 
  6. ^ Froese, Rainer and Pauly, Daniel, eds. (2009). "Forcipiger longirostris" in FishBase. January 2009 version.
  7. ^ "QUEST - Fish Identification List" (Microsoft Word). Kalakaua Marine Education Center, University of Hawaii at Hilo. Retrieved 2009-04-20. 
  8. ^ "Hawaiian Marine Communities". Waikiki Aquarium. Retrieved 2009-04-20. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!