Overview

Brief Summary

Introduction

Introduction:

A neotropical genus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Leptree.net

Source: LepTree

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

A neotropical genus.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:52Public Records:42
Specimens with Sequences:52Public Species:3
Specimens with Barcodes:50Public BINs:2
Species:3         
Species With Barcodes:2         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eutychide Janzen02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eutychide Janzen02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGAACAGAATTAGGAAATCCTGGTTCACTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAACAATATAAGATTTTGAATATTACCCCCTTCATTAATATTACTAATTTCTAGAAGAATTGTTGAAAATGGTGCAGGTACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCACCAAGGTTCTTCAGTTGATCTAGCAATTTTCTCCCTACACTTAGCAGGAATTTCTTCTATTTTAGGAGCCATTAACTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCCCTATTATTATTATTATCATTACCTGTATTAGCAGGTGCAATTACAATACTTTTAACCGACCGAAATTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Eutychide

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eutychide

Eutychide is a genus of skippers in the family Hesperiidae.

Species[edit]

References[edit]

  1. ^ Eutychide at funet.fi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!