Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in clear lagoon and seaward reefs (Ref. 1602). Juveniles usually solitary; adults form harems (Ref. 9710); males are territorial. Goes to several changes during growth and very large females change sex to the brightly colored male. Small juveniles usually in dense coral and algae habitats (Ref. 48636). Benthic grazer of algae (Ref. 3488). Caught with nets and other types of artisanal gear.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the Red Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea to the Tuamoto Islands, north to the Izu Island, south to the southern Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea endemic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

90.0 cm TL (male/unsexed; (Ref. 2871))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in clear lagoon and seaward reefs at depths of 1 to at least 30 m (Ref. 1602). Usually solitary; adult males territorial and haremic. Benthic grazer of algae (Ref. 3488). Caught with nets and other types of artisanal gear.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a large parrotfish at 45-50 cm for terminal phase adults. This species occurs in small haremic groups in reef fronts and passes. It inhabits rich coral areas of seaward and lagoon reefs (G. Allen pers comm. 2009). There is no data available on demography and reproductive biology.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 9710), usually 1 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 1.83 - 43
  Temperature range (°C): 27.072 - 29.282
  Nitrate (umol/L): 0.069 - 1.251
  Salinity (PPS): 34.090 - 35.125
  Oxygen (ml/l): 4.438 - 4.700
  Phosphate (umol/l): 0.085 - 0.214
  Silicate (umol/l): 1.328 - 4.407

Graphical representation

Depth range (m): 1.83 - 43

Temperature range (°C): 27.072 - 29.282

Nitrate (umol/L): 0.069 - 1.251

Salinity (PPS): 34.090 - 35.125

Oxygen (ml/l): 4.438 - 4.700

Phosphate (umol/l): 0.085 - 0.214

Silicate (umol/l): 1.328 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Herbivorous (Ref. 43650).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Metacercaria Infection (Flatworms). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cetoscarus bicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCTCTAAGCCTTCTTATTCGGGCAGAATTGAGCCAGCTCGGAGCTCTTCTCGGAGATGACCAGATTTATAATGTTATCGTTACAGCTCACGCATTTGTAATAATCTTTTTTATAGTCATGCCAATCATGATTGGAGGGTTTGGAAACTGACTCATCCCACTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGAATGAACAACATAAGCTTCTGACTTCTTCCTCCCTCCTTCCTCCTACTTCTTGCCTCCTCTGGCGTAGAAGCTGGGGCAGGCACTGGATGAACCGTCTACCCCCCACTAGCCGGAAACCTCGCACATGCAGGTGCATCCGTAGACTTAACAATTTTCTCCCTTCACCTGGCTGGAATCTCCTCAATCCTCGGGGCAATTAATTTTATTACAACAATTATTAATATGAAACCGCCCGCTATTTCCCAATACCAAACCCCCCTGTTCGTATGGGCTGTTTTAATTACTGCTGTTCTTCTTCTTCTTTCACTTCCTGTTCTTGCTGCAGGGATCACAATACTGCTCACAGACCGAAACTTAAATACCACTTTTTTCGATCCTGCAGGAGGGGGAGACCCGATTCTCTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cetoscarus bicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Western Australian Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., Russell, B., Clements, K.D., Rocha, L.A., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is found in the Red Sea and is abundant for a large parrotfish. Although it is a component of subsistence fisheries, it is found in marine reserves in parts of its range. It is listed as Least Concern.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species has a restricted distribution but is reasonably common over coral reefs within the Red Sea. In the northern Red Sea, it is found on outer reef slopes with a mean density of 2.2 per 1000 m2 (J.H. Choat pers comm. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cetoscarus bicolor

Cetoscarus bicolor, the bicolour parrotfish, is a species of fish belonging to the family Scaridae. It is found in the Indo-Pacific, including the Red Sea.

Taxonomy[edit]

It is monotypic within the genus Cetoscarus, although the scientific name C. bicolor has been suggested to be reserved for the population in the Red Sea, in which case the remaining populations are named C. ocellatus.[2]

Description[edit]

Juvenile of Cetoscarus bicolor. Bunaken, Sulawesi, Indonesia

It is among the largest parrotfishes, growing to a length of up to 90 cm (35 in).[3] As in many of its relatives, it is a sequential hermaphrodite, starting as female (known as the initial phase) and then changing to male (the terminal phase). The initial phase is dark brown with a large cream patch on the upper part of the body. The terminal phase is very colourful, overall green with pink spotting to the body and edging to the fins. Juveniles are white with a black spot on the dorsal fin and an orange band through the eye.

Distribution and habitat[edit]

This species can be found in the Indo-Pacific, from the Red Sea to the Tuamotu Islands, Izu Islands and southern Great Barrier Reef.[4] The bicolour parrotfish is associated with coral reefs. It usually can be found in lagoons and seaward reefs at depths between 1 and 30 m (3 ft 3 in and 98 ft 5 in).[5] Small juveniles are usually found among dense coral and in algae-rich habitats.[6]

Behaviour[edit]

Male bicolour parrotfish are territorial. During its lifetime, this fish changes sex several times and very large females change sex to become brightly coloured males. This parrotfish mainly feeds on algae.[6]

Status[edit]

The bicolour parrotfish is a common fish within its somewhat limited range. No particular threats have been identified for this species and parts of its range are within marine protected areas and the IUCN has listed it as being of "Least Concern".[1]

References[edit]

  1. ^ a b Choat, J.H., Russell, B., Clements, K.D., Rocha, L.A., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P. 2012. Cetoscarus bicolor. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 10 September 2013.
  2. ^ Randall, J. E. (2005). Reef and Shore Fishes of the South Pacific. University of Hawi'i Press. ISBN 0824826981
  3. ^ http://www.fishbase.org/summary/5538
  4. ^ http://eol.org/pages/204367/details#distribution
  5. ^ http://eol.org/pages/204367/details#habitat
  6. ^ a b "Cetoscarus bicolor (Rüppell, 1829): Bicolour parrotfish". FishBase. Retrieved 2013-12-26. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!