Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in clear lagoon and seaward reefs (Ref. 1602). Juveniles usually solitary; adults form harems (Ref. 9710); males are territorial. Goes to several changes during growth and very large females change sex to the brightly colored male. Small juveniles usually in dense coral and algae habitats (Ref. 48636). Benthic grazer of algae (Ref. 3488). Caught with nets and other types of artisanal gear.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea to the Tuamoto Islands, north to the Izu Island, south to the southern Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea endemic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

90.0 cm TL (male/unsexed; (Ref. 2871))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in clear lagoon and seaward reefs at depths of 1 to at least 30 m (Ref. 1602). Usually solitary; adult males territorial and haremic. Benthic grazer of algae (Ref. 3488). Caught with nets and other types of artisanal gear.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 1.83 - 43
  Temperature range (°C): 27.072 - 29.282
  Nitrate (umol/L): 0.069 - 1.251
  Salinity (PPS): 34.090 - 35.125
  Oxygen (ml/l): 4.438 - 4.700
  Phosphate (umol/l): 0.085 - 0.214
  Silicate (umol/l): 1.328 - 4.407

Graphical representation

Depth range (m): 1.83 - 43

Temperature range (°C): 27.072 - 29.282

Nitrate (umol/L): 0.069 - 1.251

Salinity (PPS): 34.090 - 35.125

Oxygen (ml/l): 4.438 - 4.700

Phosphate (umol/l): 0.085 - 0.214

Silicate (umol/l): 1.328 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 9710), usually 1 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 1.83 - 43
  Temperature range (°C): 27.072 - 29.282
  Nitrate (umol/L): 0.069 - 1.251
  Salinity (PPS): 34.090 - 35.125
  Oxygen (ml/l): 4.438 - 4.700
  Phosphate (umol/l): 0.085 - 0.214
  Silicate (umol/l): 1.328 - 4.407

Graphical representation

Depth range (m): 1.83 - 43

Temperature range (°C): 27.072 - 29.282

Nitrate (umol/L): 0.069 - 1.251

Salinity (PPS): 34.090 - 35.125

Oxygen (ml/l): 4.438 - 4.700

Phosphate (umol/l): 0.085 - 0.214

Silicate (umol/l): 1.328 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Herbivorous (Ref. 43650).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Metacercaria Infection (Flatworms). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cetoscarus bicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCTCTAAGCCTTCTTATTCGGGCAGAATTGAGCCAGCTCGGAGCTCTTCTCGGAGATGACCAGATTTATAATGTTATCGTTACAGCTCACGCATTTGTAATAATCTTTTTTATAGTCATGCCAATCATGATTGGAGGGTTTGGAAACTGACTCATCCCACTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGAATGAACAACATAAGCTTCTGACTTCTTCCTCCCTCCTTCCTCCTACTTCTTGCCTCCTCTGGCGTAGAAGCTGGGGCAGGCACTGGATGAACCGTCTACCCCCCACTAGCCGGAAACCTCGCACATGCAGGTGCATCCGTAGACTTAACAATTTTCTCCCTTCACCTGGCTGGAATCTCCTCAATCCTCGGGGCAATTAATTTTATTACAACAATTATTAATATGAAACCGCCCGCTATTTCCCAATACCAAACCCCCCTGTTCGTATGGGCTGTTTTAATTACTGCTGTTCTTCTTCTTCTTTCACTTCCTGTTCTTGCTGCAGGGATCACAATACTGCTCACAGACCGAAACTTAAATACCACTTTTTTCGATCCTGCAGGAGGGGGAGACCCGATTCTCTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cetoscarus bicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Western Australian Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cetoscarus bicolor

Cetoscarus bicolor, the bicolour parrotfish, is a species of fish belonging to the family Scaridae. It is found in the Red Sea.

Distribution and habitat[edit]

This species can be found in the Red Sea. The similar species which is widespread in the Indo-Pacific is Cetoscarus ocellatus.[2] The bicolour parrotfish is associated with coral reefs. It usually can be found in lagoons and seaward reefs at depths between 1 and 30 m (3 ft 3 in and 98 ft 5 in).[3] Small juveniles are usually found among dense coral and in algae-rich habitats.[4]

Description[edit]

Juvenile of Cetoscarus bicolor. Bunaken, Sulawesi, Indonesia

It is among the largest parrotfishes, growing to a length of up to 90 cm (35 in).[5] As in many of its relatives, it is a sequential hermaphrodite, starting as female (known as the initial phase) and then changing to male (the terminal phase). The initial phase is dark brown with a large cream patch on the upper part of the body. The terminal phase is very colourful, overall green with pink spotting to the body and edging to the fins. Juveniles are white with a black spot on the dorsal fin and an orange band through the eye.

Behaviour[edit]

Male bicolour parrotfish are territorial. During its lifetime, this fish changes sex twice and very large females change sex to become brightly coloured males. This parrotfish mainly feeds on algae.[4]

Etymology[edit]

It is monotypic within the genus Cetoscarus, although the scientific name C. bicolor has been suggested to be reserved for the population in the Red Sea, in which case the remaining populations are named C. ocellatus.[6]

References[edit]

  1. ^ Choat, J.H., Russell, B., Clements, K.D., Rocha, L.A., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P. 2012. Cetoscarus bicolor. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 10 September 2013.
  2. ^ http://eol.org/pages/204367/details#distribution
  3. ^ http://eol.org/pages/204367/details#habitat
  4. ^ a b "Cetoscarus bicolor (Rüppell, 1829): Bicolour parrotfish". FishBase. Retrieved 2013-12-26. 
  5. ^ Froese, Rainer and Pauly, Daniel, eds. (2014). "Cetoscarus bicolor" in FishBase. December 2014 version.
  6. ^ Randall, J. E. (2005). Reef and Shore Fishes of the South Pacific. University of Hawi'i Press. ISBN 0824826981
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!