Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Ranging into subtropical zones as juveniles expatriate caused by warm currents during pelagic stage (Ref. 48636). Adults inhabit coral-rich outer reef slopes at depths of 5 to over 20 m, particularly near caves. Juveniles in caves; adults swim openly about, but usually close to the substrate, and often engage in cleaning larger fishes (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-Pacific from the Niccobar Islands and eastward to Tonga. It is recorded from Wakayama Prefecture, Japan in the north and south to Elizabeth Reef and Sydney in eastern Australia and New Caledonia.

It is common in museum collections and is evidently excluded from the oceanic mid-Pacific plate (Gomon 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific between Wakayama Pref., Japan and Sydney, Australia, New Caledonia and Fiji. Indian Ocean, along the western coast of Malaysia and Indonesia, and at least in the Nicobars at the edge of the Andaman Sea. Evidently excluded from the oceanic mid-Pacific plate;
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Eastern Indonesia and Phippines east to Palau and Fiji, north to southern Taiwan, south to Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 9 - 10; Analspines: 3; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 30874))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Juveniles and adults resemble their counterparts of B. axillaris, but juveniles have yellow rather than white spots and adults have well-defined black band between the light and dark portions of the body and lack ocelli on the dorsal and anal fins. Color of juveniles changes completely to adult pattern when about 5-6 cm long. The change takes only a few weeks and intermediates are rarely seen (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A moderately small species, to about 147 mm SL. Ranging into subtropical zones as juveniles expatriates caused by warm currents during pelagic stage (Kuiter andTonozuka 2001). Adults occur mostly at depths of one to 20 m on coral and rock reefs, especially on steep, coral-rich slopes. Juveniles in caves, adults swim openly about, but usually close to the substrate, and often engage in cleaning larger fishes (Kuiter and Tonozuka 2001).
Juveniles are not well represented in collections, but do appear to occur in depths similar to those of adults (Gomon 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 5 - 40 m (Ref. 37816), usually 5 - 20 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 3 - 39
  Temperature range (°C): 26.173 - 29.282
  Nitrate (umol/L): 0.019 - 1.118
  Salinity (PPS): 32.185 - 35.263
  Oxygen (ml/l): 4.202 - 4.701
  Phosphate (umol/l): 0.088 - 0.337
  Silicate (umol/l): 0.567 - 5.552

Graphical representation

Depth range (m): 3 - 39

Temperature range (°C): 26.173 - 29.282

Nitrate (umol/L): 0.019 - 1.118

Salinity (PPS): 32.185 - 35.263

Oxygen (ml/l): 4.202 - 4.701

Phosphate (umol/l): 0.088 - 0.337

Silicate (umol/l): 0.567 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 25m.
From 5 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Scaphanocephalus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bodianus mesothorax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bodianus mesothorax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGGACCGCGCTAAGTTTACTTATCCGGGCAGAACTAAGCCAACCGGGAGCTCTCCTAGGAGACGACCAGATTTACAATGTAATCGTTACAGCGCATGCGTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGCGGCTTTGGAAACTGACTTATTCCACTAATGATCGGGGCCCCCGACATGGCTTTCCCTCGAATGAACAACATGAGCTTCTGACTTCTCCCCCCGTCTTTCCTCCTTCTCCTGGCCTCTTCTGGTGTAGAAGCTGGTGCCGGAACTGGGTGAACTGTTTACCCCCCTCTAGCAGGCAATCTGGCCCACGCGGGAGCCTCGGTTGACCTAACCATCTTCTCCCTTCACCTGGCAGGAATTTCATCGATCCTTGGAGCAATCAATTTTATTACAACAATTATCAACATGAAACCGCCGGCCATCTCTCAATACCAAACCCCCCTGTTCGTCTGAGCCGTGCTCATCACAGCCGTGCTTCTTCTACTCTCACTACCAGTACTTGCTGCCGGGATCACAATGCTATTAACAGACCGAAATCTAAACACCACCTTCTTCGACCCAGCGGGAGGGGGAGACCCAATTCTATACCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Russell, B.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species has a widespread distribution in the Indo-West Pacific. It is a moderately small species sought by aquarium fish collectors, but there is no available catch data. There are no major threats known. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is not uncommon. There is no specific population information available for this species.

On the east coast of Peninsular Malaysia, an estimated mean density of 0.05 individuals from twenty 50 m X 5 m transects was recorded in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Split-level hogfish

The split-level hogfish, Bodianus mesothorax, is a species of wrasse native to the western Pacific Ocean and the eastern Indian Ocean. They can be found on reefs at depths of 5 to 40 m (16 to 131 ft), though rarely below 20 m (66 ft). Juveniles inhabit caves in the reef. Adults clean other fishes. This species can reach a length of 25 cm (9.8 in). This species can be found in the aquarium trade.[2]

References[edit]

  1. ^ Russell, B. 2010. Bodianus mesothorax. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. www.iucnredlist.org. Downloaded on 01 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Bodianus mesothorax" in FishBase. August 2013 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!