Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults are found in coral rich areas of seaward reefs (Ref. 5213). Reported to be associated with the mushroom Heliofungia actiniformis (Ref. 91291). Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is the most common Bodianus in the western Indian Ocean and, in particular, the Mozambique Channel. It occurs from the Red Sea to South Africa (Natal), Comoro Is, Aldabra, Seychelles, Mauritius, Reunion, Chagos Archipelago, Maldives, Sri Lanka, Nicobars, Cocos-Keeling. This species is also reliably reported from Kenya, Gulf of Aden, Gulf of Oman and Pakistan (Gomon 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian Ocean: East Africa (but not the Red Sea, Gulf of Aden, or Somalia), east to the Nicobar Islands and Cocos-Keeling Islands (Ref. 75973). Replaced by Bodianus dictynna in the tropical Western Pacific and the the longer snouted Bodianus prognathus in the Line Islands (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indian Ocean: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Nicobar Islands and Cocos-Keeling Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 250 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

16.9 cm SL (male/unsexed; (Ref. 75973))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found in coral rich areas of seaward reefs (Ref. 5213). Juveniles often shelter near black corals and gorgonians; also frequent cave ceilings (Ref. 8631). Feeds mainly on benthic invertebrates such as molluscs and crustaceans.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal-fin rays XII, 10; analfinrays III, 12; caudal-fin rays 10 (6) or 11 (4) + 12 + 10;pectoral-fin rays ii, 11 (1), 13 (1), 14 (19) or 15 (3); predorsalscales ?22–25; total gill rakers 15 (1) or 17 (5). See Tables2 and 8 for morphometric values. Head and snout elongate;jaws attenuate. Cheek scales reaching forward on upper sideof mouth to below or slightly in advance of anterior extentof orbit, scales reaching forward on lower jaw slightly inadvance of posterior corner of mouth; single scale usuallyapparent midway between corner of mouth and anterior tipof jaw. Upper jaw with first prominent anterior canine equalto or slightly smaller than second; first canine directedanteroventrally, tip often curved ventrally; second caninedirected ventrolaterally and slightly anteriorly, tipoccasionally curved ventrally; dental ridge mostly straightwith ?6–21 very small canines; single moderately largeprominent canine at posterior end of jaw directedanteroventrally and slightly laterally in small individuals,directed more anteriorly in larger specimens. Lower jawwith first prominent anterior canine ?2?3–¾ length of second;first canine directed anterodorsally and usually slightlylaterally, tip often curved dorsally; dental ridge usually longand continuous with about 15–22 very small canines insingle row; teeth becoming only slightly larger posteriorly;teeth occasionally separable into 2 series. Pelvic fin short,posterior tip approaching anus only in small individuals.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a moderately small species, to about 169 mm SL. It is almost always associated with living coral reefs (Fischer et al. 1990). Juveniles often shelter near black corals and gorgonians, also frequent cave ceilings (Kuiter1992). It feeds mainly on benthic invertebrates such as mollusks and crustaceans. Juveniles regularly remove parasites from other fishes (Kuiter and Tonozuka 2001). Although usually found at depths of 9–30 m, individuals have been taken at 36–49 m at Cocos-Keeling Atoll.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine, usually 6 - 25 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 4.5 - 37.5
  Temperature range (°C): 24.677 - 28.575
  Nitrate (umol/L): 0.048 - 0.694
  Salinity (PPS): 32.464 - 35.295
  Oxygen (ml/l): 4.427 - 4.859
  Phosphate (umol/l): 0.169 - 0.350
  Silicate (umol/l): 3.311 - 5.317

Graphical representation

Depth range (m): 4.5 - 37.5

Temperature range (°C): 24.677 - 28.575

Nitrate (umol/L): 0.048 - 0.694

Salinity (PPS): 32.464 - 35.295

Oxygen (ml/l): 4.427 - 4.859

Phosphate (umol/l): 0.169 - 0.350

Silicate (umol/l): 3.311 - 5.317
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 100m.
From 5 to 100 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bodianus diana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Bodianus diana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCCTGAGCCGGAATGGTCGGTACCGCGCTAAGTTTACTTATCCGGGCCGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTACAATGTCATTGTTACGGCGCATGCGTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGCGGCTTTGGGAACTGGCTCATTCCGCTAATGATTGGAGCACCCGATATGGCCTTCCCTCGAATGAATAACATAAGCTTCTGGCTTCTTCCCCCGTCCTTCCTCCTTCTCCTAGCGTCTTCTGGCGTAGAGGCTGGGGCCGGAACTGGGTGAACTGTTTACCCCCCGCTAGCGGGCAATCTCGCCCACGCAGGAGCATCAGTTGACCTCACCATCTTCTCCCTTCACTTGGCAGGGGTCTCATCAATCCTAGGGGCAATCAATTTTATCACAACTATTATTAACATGAAGCCACCAGCCATCTCTCAGTATCAAACCCCATTATTCGTTTGAGCCGTGCTTATTACAGCTGTACTCCTTCTGCTCTCCCTACCGGTCCTTGCTGCCGGAATTACAATGCTCCTGACGGACCGAAACCTAAATACCACCTTTTTCGACCCAGCGGGAGGGGGAGACCCAATCCTGTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Russell, B.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the Indian Ocean and very common. There are no major threats. It is a moderately small species sought by aquarium fish collectors, but there is no catch data.This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. This is the most common species in the genus.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Possible threats from reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bodianus diana

Diana's hogfish, Bodianus diana, is a species of wrasse native to the Indian Ocean from the African coast to the Nicobars and the Cocos-Keeling Islands. Reports of its presence in the western Pacific Ocean are erroneous. It occurs on the seaward side of reefs at depths from 6 to 50 m (20 to 160 ft) (though rarely deeper than 25 m (82 ft)). It can reach a length of 16.9 cm (6.7 in). This species is of minor importance to local commercial fisheries and is found in the aquarium trade.[2]

References[edit]

  1. ^ Russell, B. 2010. Bodianus diana. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 05 September 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Bodianus diana" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!