Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit clear lagoon and seaward reefs (Ref. 1602); common in clear shallow waters at 1-8 m; large individuals occasionally at greater depths below 27 m (Ref. 75973). Juveniles occur solitary in caves or under ledges and act as cleaners by picking at bodies of other fishes (adults occasionally do this) (Ref. 1602); occurring regularly at depths of 14-26 m (Ref. 75973). Feed mainly on benthic, hard-shelled, invertebrates such as mollusks and crustaceans (Ref. 9823). Oviparous, distinct pairing during breeding (Ref. 205). Not commonly marketed. Occasionally seen in the aquarium trade.
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-Pacific from the Red Sea to Durban, South Africa and extending eastward to Pitcairn Island. It appears to be excluded from the coasts of India. In the Western Pacific, it is found from Okinawa, Japan in the north to eastern and western Australia (B. Russell pers. comm. 2008) in the south.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea to South Africa (Ref. 35918), east to the Marshall, Marquesan and Tuamoto islands, north to Japan (Ref. 559).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East and South Africa, Madagascar and Mascarenes east to Line Islands, Marquesas Islands and Pitcairn Group, north to southern Japan and Marshall Islands, south to Western Australia, New South Wales (Australia), New Caledonia,
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 9 - 10; Analspines: 3; Analsoft rays: 12 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits clear lagoon and seaward reefs. Juveniles are usually found in caves or under ledges and act as cleaners by picking at bodies of other fishes (adults occasionally do this) (Ref. 1602). Feeds mainly on benthic, hard-shelled, invertebrates such as molluscs and crustaceans (Ref. 9823). Not commonly marketed for food. Occasionally seen in the aquarium trade.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Juveniles and females easily recognized by the generally black body with large white spots; males have large black spots on the soft parts of the dorsal and anal fins (Ref. 48636). Juveniles resemble the juveniles of B. mesothorax but have white rather than yellow spots. Undergoes a dramatic color change with growth.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is moderately small, to about 143 mm SL. It inhabits clear lagoon and seaward reefs. Adults occur commonly in clear shallow waters at depths of 1-8 m. Large individuals do occasionally occur at somewhat greater depths, having been collected below 27 m at Cocos-Keeling Atoll. Juveniles are often found in caves and beneath ledges in moderately deep waters, occurring regularly at depths of 14 to 26 m. It is almost always associated with well-developed coral reefs. It feeds mainly on benthic, hard-shelled, invertebrates such as mollusks and crustaceans. Juveniles act as cleaners by picking at bodies of other fishes (adults occasionally do this).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 100 m (Ref. 9823), usually 2 - 40 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 2.5 - 57
  Temperature range (°C): 25.712 - 28.905
  Nitrate (umol/L): 0.019 - 1.522
  Salinity (PPS): 32.200 - 35.924
  Oxygen (ml/l): 4.406 - 4.802
  Phosphate (umol/l): 0.103 - 0.339
  Silicate (umol/l): 0.897 - 4.599

Graphical representation

Depth range (m): 2.5 - 57

Temperature range (°C): 25.712 - 28.905

Nitrate (umol/L): 0.019 - 1.522

Salinity (PPS): 32.200 - 35.924

Oxygen (ml/l): 4.406 - 4.802

Phosphate (umol/l): 0.103 - 0.339

Silicate (umol/l): 0.897 - 4.599
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 100m.
From 2 to 100 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bodianus axillaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bodianus axillaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACCGCCCTGAGCTTACTTATCCGGGCGGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTACAACGTGATCGTTACAGCCCATGCGTTCGTAATAATCTTCTTTATAGTAATGCCGATTATGATCGGCGGCTTCGGGAACTGGCTCATTCCACTAATGATCGGAGCCCCCGACATGGCCTTTCCTCGAATAAACAACATAAGCTTCTGACTTCTACCTCCGTCCTTCCTCCTTCTCCTGGCCTCTTCTGGAGTAGAAGCCGGTGCCGGAACCGGATGAACTGTCTACCCCCCACTAGCAGGCAATCTAGCCCACGCAGGAGCCTCAGTTGACTTGACAATTTTCTCCCTTCACTTGGCAGGAATCTCATCAATTCTAGGAGCAATCAATTTTATTACAACTATTATCAACATAAAACCACCAGCTATCTCCCAATACCAAACCCCCCTGTTCGTCTGAGCCGTGCTCATCACAGCTGTTCTCCTCCTCCTCTCACTACCGGTACTCGCTGCCGGAATTACGATGCTATTAACGGACCGAAACCTAAACACCACCTTCTTTGACCCAGCAGGAGGGGGAGACCCAATTCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Russell, B.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
Little is known about the population and life history characteristics of this species. It is very widespread throughout the Indo-West Pacific and is common. It is moderately small and sought by aquarium fish collectors, but there is no catch data. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species. This is a common and widespread species.

In Pangkor Island, Malaysia an estimated mean density of 0.33 individuals from three 100 m X 2 m transects was recorded in underwater fish visual surveys (Y. Yusuf unpublished data).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is not commonly marketed and is occasionally seen in the aquarium trade. It is sometimes caught as fisheries bycatch.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; bait: occasionally; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Axilspot hogfish

The axilspot hogfish, Bodianus axillaris, is a species of wrasse native to the Indo-Pacific.

Etymology[edit]

The genus name Bodianus, after Bodiano or Pudiano, derives from the Portuguese word pudor, meaning modesty.

Description[edit]

Adult fishes are about 20 cm long. Males are red-brown anteriorly, and white posteriorly. They have large, dark spots on their pectoral fin bases, soft dorsal fins, and anal fins. Juveniles and females are black with a few large, white patches.[2]

This oviparous species mainly feeds on mollusks and crustaceans and other benthic hard-shell invertebrates.[2][3] It is also an aquarium fish.[2][4]

Distribution[edit]

This species is mainly found in the Indo-Pacific, from Red Sea to South Africa, Marshall Islands, Marquesan and Tuamoto Islands, north to Japan.[2]

Habitat[edit]

Bodianus axillaris is a reef-associated species. It usually can be found in lagoons and seaward reefs, in caves or under ledges at depths between 2 and 100 m.[2]

References[edit]

  1. ^ Russell, B. 2010. Bodianus axillaris. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 01 November 2013.
  2. ^ a b c d e Fish Base
  3. ^ Australian Museum Fish Site
  4. ^ Encyclopedia of Life
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!