Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur in outer lagoon and seaward reefs. They inhabit branching coral heads, particularly Pocillopora eydouxi. Form schools, often in silty habitats (Ref. 48636). Male prepares a nest by cleaning with its mouth a rock or coral surface where the female will attach the eggs (Ref. 5503). Oviparous, distinct pairing during breeding (Ref. 205).
  • Randall, H.A. and G.R. Allen 1977 A revision of the damselfish genus Dascyllus (Pomacentridae) with description of a new species. Rec. Aust. Mus. 31(9):349-385. (Ref. 2746)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: Cocos-Keeling Islands in the eastern Indian Ocean to Samoa and the Line Islands, north to southern Japan, south to Rowley Shoals (eastern Indian Ocean) and Lord Howe Island (Ref. 37816). Not found in the Hawaiian and Society islands and islands beyond. Replaced by Dascyllus carneus in the Indian Ocean (Ref. 37816).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 14 - 16; Analspines: 2; Analsoft rays: 12 - 14
  • Randall, H.A. and G.R. Allen 1977 A revision of the damselfish genus Dascyllus (Pomacentridae) with description of a new species. Rec. Aust. Mus. 31(9):349-385. (Ref. 2746)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.0 cm TL (male/unsexed; (Ref. 30874))
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Color variable according to ecological and behavioral conditions: basically body whitish with snout, interorbital and forehead greenish; black bar on anterior and a fainter one on posterior part of the body; blackish scale margins; pelvic fins mostly black; pectorals transparent with a spot on its base. Margins of preorbital, suborbital, and preoperculum finely serrated (Ref. 2746). Body depth 1.4-1.6 in SL (Ref. 90102).
  • Randall, H.A. and G.R. Allen 1977 A revision of the damselfish genus Dascyllus (Pomacentridae) with description of a new species. Rec. Aust. Mus. 31(9):349-385. (Ref. 2746)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs in outer lagoon and seaward reefs. Inhabits branching coral heads, particularly @Pocillopora eydouxi@. Forms schools. Male prepares a nest by cleaning with its mouth a rock or coral surface where the female will attach the eggs (Ref. 5503).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 50 m (Ref. 1602)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 140 specimens in 1 taxon.
Water temperature and chemistry ranges based on 88 samples.

Environmental ranges
  Depth range (m): 0.5 - 41
  Temperature range (°C): 25.161 - 29.205
  Nitrate (umol/L): 0.019 - 0.895
  Salinity (PPS): 33.845 - 35.924
  Oxygen (ml/l): 4.436 - 4.812
  Phosphate (umol/l): 0.073 - 0.293
  Silicate (umol/l): 0.721 - 4.752

Graphical representation

Depth range (m): 0.5 - 41

Temperature range (°C): 25.161 - 29.205

Nitrate (umol/L): 0.019 - 0.895

Salinity (PPS): 33.845 - 35.924

Oxygen (ml/l): 4.436 - 4.812

Phosphate (umol/l): 0.073 - 0.293

Silicate (umol/l): 0.721 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 50m.
From 1 to 50 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in outer lagoon and seaward reefs. Inhabits branching coral heads, particularly Pocillopora eydouxi. Forms schools (Ref. 5503). Feeds on plants, benthic and planktonic invertebrates (Ref. 26990).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Benthic spawner. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Godwin, J. 1995 Phylogenetic and habitat influences on mating system structure in the humbug damselfishes (Dascyllus, Pomacentridae). Bull. Mar. Sci. 57(3):637-652. (Ref. 33146)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dascyllus reticulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCCTGAGCTGGGATAGTAGGTACAGCCCTAAGCCTGCTTATCCGGGCAGAGCTGAGCCAACCAGGCGCTCTTCTAGGAGACGACCAGATTTATAATGTTATCGTTACAGCGCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGGTTTGGAAACTGGCTGATTCCTCTCATGATTGGAGCCCCTGACATAGCATTCCCTCGAATGAATAATATGAGTTTCTGACTTTTGCCCCCTTCATTCCTTCTTCTGCTAGCCTCCTCTGGCGTCGAAGCAGGTGCAGGCACAGGATGAACCGTATACCCTCCCCTATCAGGAAACCTGGCTCATGCGGGAGCTTCCGTAGATCTAACCATTTTCTCGCTCCATCTGGCAGGAATTTCCTCAATCCTGGGAGCAATCAACTTTATCACAACTATCGTTAACATGAAGCCTCCCGCTATTACCCAGTATCAGACTCCTCTTTTCGTGTGAGCCGTCCTTATTACTGCTGTTCTTCTCCTTCTTTCCCTCCCAGTCCTAGCCGCTGGAATTACCATGCTCTTAACTGATCGTAATTTAAATACTACATTCTTTGACCCAGCAGGAGGGGGAGACCCAATCCTCTATCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dascyllus reticulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Western Australian Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!