Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur in outer lagoon and seaward reefs. They inhabit branching coral heads, particularly Pocillopora eydouxi. Form schools, often in silty habitats (Ref. 48636). Male prepares a nest by cleaning with its mouth a rock or coral surface where the female will attach the eggs (Ref. 5503). Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: Cocos-Keeling Islands in the eastern Indian Ocean to Samoa and the Line Islands, north to southern Japan, south to Rowley Shoals (eastern Indian Ocean) and Lord Howe Island (Ref. 37816). Not found in the Hawaiian and Society islands and islands beyond. Replaced by Dascyllus carneus in the Indian Ocean (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 14 - 16; Analspines: 2; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.0 cm TL (male/unsexed; (Ref. 30874))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in outer lagoon and seaward reefs. Inhabits branching coral heads, particularly @Pocillopora eydouxi@. Forms schools. Male prepares a nest by cleaning with its mouth a rock or coral surface where the female will attach the eggs (Ref. 5503).
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Color variable according to ecological and behavioral conditions: basically body whitish with snout, interorbital and forehead greenish; black bar on anterior and a fainter one on posterior part of the body; blackish scale margins; pelvic fins mostly black; pectorals transparent with a spot on its base. Margins of preorbital, suborbital, and preoperculum finely serrated (Ref. 2746). Body depth 1.4-1.6 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 50 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 140 specimens in 1 taxon.
Water temperature and chemistry ranges based on 88 samples.

Environmental ranges
  Depth range (m): 0.5 - 41
  Temperature range (°C): 25.161 - 29.205
  Nitrate (umol/L): 0.019 - 0.895
  Salinity (PPS): 33.845 - 35.924
  Oxygen (ml/l): 4.436 - 4.812
  Phosphate (umol/l): 0.073 - 0.293
  Silicate (umol/l): 0.721 - 4.752

Graphical representation

Depth range (m): 0.5 - 41

Temperature range (°C): 25.161 - 29.205

Nitrate (umol/L): 0.019 - 0.895

Salinity (PPS): 33.845 - 35.924

Oxygen (ml/l): 4.436 - 4.812

Phosphate (umol/l): 0.073 - 0.293

Silicate (umol/l): 0.721 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 50m.
From 1 to 50 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in outer lagoon and seaward reefs. Inhabits branching coral heads, particularly Pocillopora eydouxi. Forms schools (Ref. 5503). Feeds on plants, benthic and planktonic invertebrates (Ref. 26990).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Benthic spawner. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dascyllus reticulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCCTGAGCTGGGATAGTAGGTACAGCCCTAAGCCTGCTTATCCGGGCAGAGCTGAGCCAACCAGGCGCTCTTCTAGGAGACGACCAGATTTATAATGTTATCGTTACAGCGCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGGTTTGGAAACTGGCTGATTCCTCTCATGATTGGAGCCCCTGACATAGCATTCCCTCGAATGAATAATATGAGTTTCTGACTTTTGCCCCCTTCATTCCTTCTTCTGCTAGCCTCCTCTGGCGTCGAAGCAGGTGCAGGCACAGGATGAACCGTATACCCTCCCCTATCAGGAAACCTGGCTCATGCGGGAGCTTCCGTAGATCTAACCATTTTCTCGCTCCATCTGGCAGGAATTTCCTCAATCCTGGGAGCAATCAACTTTATCACAACTATCGTTAACATGAAGCCTCCCGCTATTACCCAGTATCAGACTCCTCTTTTCGTGTGAGCCGTCCTTATTACTGCTGTTCTTCTCCTTCTTTCCCTCCCAGTCCTAGCCGCTGGAATTACCATGCTCTTAACTGATCGTAATTTAAATACTACATTCTTTGACCCAGCAGGAGGGGGAGACCCAATCCTCTATCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dascyllus reticulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Western Australian Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dascyllus reticulatus

Dascyllus reticulatus, known commonly as the Reticulate dascyllus or Two Stripe Damselfish among other vernacular names, is a species of marine fish in the family Pomacentridae. [1]

Reticulate dascyllus is widespread throughout the tropical waters of the central Indo-Pacific region.[1]

Description[edit]

A small marine fish that reaches 9 centimetres (3.5 in) in length. It is grey with two vertical stripes, and a blue-green tail.

In the aquarium[edit]

Dascyllus melanurus is a hardy member of a saltwater aquarium. Because of this and its usually low price it may be recommended as a way for novice marine aquarium keepers to gain experience in the hobby. 114 litres (30 US gal) is typically quoted as the minimum tank size required to permanently house this fish.

It is an aggressive fish, even when compared to many damselfish, and will often harass similarly sized fish. It is also territorial with members of its own species, and with new additions to a tank. This will often make it difficult to add other small fish to an aquarium. It is however reef safe and will not harm invertebrates. Despite its hardy nature care should be taken when placing one with larger predatory fish such as lion fish, and grouper which will may eat it. As an adult however its aggressive nature will often protect it from any fish that cannot fit it in its mouth.

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2015). "Dascyllus reticulatus" in FishBase. January 2015 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!