Overview

Comprehensive Description

Biology

Found between rocks and corals of intertidal reef flats, also in shallow lagoon and seaward reefs to depths of at least 10 m (Ref. 9710, 58302). Are benthic (Ref. 58302). Feed mainly on crustaceans. Protogynous hermaphroditism unconfirmed for this species (Ref. 84746). Safely kept with small aquarium fishes (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: moray (English), morena (Espanol)
 
Echidna nebulosa (Ahl, 1789)


Starry moray,     Snowflake moray



Snout short and jaws short, broad; front nostril tubular, rear one a small hole above front of eye; no canine teeth;  molar-like teeth on roof of mouth, short stout conical teeth at front of jaws; side of jaws with 1-2 rows of small close-set compressed nodular teeth; length of tail very slightly greater than ½ TL; gill opening a small slit at mid-flank; dorsal and anal fins skin covered, but evident; dorsal origin before gill opening,  anal origin immediately after anus; tip of tail blunt, with a skin-covered fin.



White, with two rows of dendritic black blotches containing small yellow spots, these blotches sometimes forming more or less complete bars on head region; numerous small black spots between large blotches; front nostrils yellow.

Size: to 80 cm.

Habitat: rocky and rubble bottoms.

Depth: 1-30 m.

Widespread in the tropical Indo-Pacific from East Africa to the Americas; the  mouth of the Gulf of California to Colombia, and all the oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (Ref. 33390) to the Society Islands, north to southern Japan and the Hawaiian Islands, south to Lord Howe Island; throughout Micronesia. Eastern Central Pacific: southern Baja California, Mexico and from Costa Rica to northern Colombia (Ref. 9324).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Rodriguez, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Panama, north to Ryukyu Islands, Ogasawara Islands and Johnston Atoll, south to Western Australia and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 30 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 80.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 48635))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body white with 2 rows of large dendritic black blotches; black spots between blotches become irregularly linear with age. Yellow eyes (Ref. 48635). 121-123 vertebrae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found between rocks and corals of intertidal reef flats, also in shallow lagoons and seaward reefs to depths of at least 10 m. Feeds mainly on crustaceans. Safely kept with small aquarium fishes (Ref. 9710).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 48 m (Ref. 58302), usually ? - 10 m (Ref. 30404)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 78 specimens in 1 taxon.
Water temperature and chemistry ranges based on 56 samples.

Environmental ranges
  Depth range (m): 0.08 - 100
  Temperature range (°C): 17.033 - 29.336
  Nitrate (umol/L): 0.047 - 26.825
  Salinity (PPS): 32.938 - 35.924
  Oxygen (ml/l): 1.080 - 4.883
  Phosphate (umol/l): 0.083 - 2.088
  Silicate (umol/l): 0.974 - 14.896

Graphical representation

Depth range (m): 0.08 - 100

Temperature range (°C): 17.033 - 29.336

Nitrate (umol/L): 0.047 - 26.825

Salinity (PPS): 32.938 - 35.924

Oxygen (ml/l): 1.080 - 4.883

Phosphate (umol/l): 0.083 - 2.088

Silicate (umol/l): 0.974 - 14.896
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated. Echidna nebulosa =  Richardson, 1845 Floral moray. Attains 70 cm. East London to southern Mozambique, Indo-Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Estuary, Mangrove

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found between rocks and corals of intertidal reef flats, also in shallow lagoon and seaward reefs to depths of at least 10 m (Ref. 9710, 58302). Benthic (Ref. 58302). Occasionally leave the water & travel between tidal pools (Ref. 1602). Feeds on fish and crabs, mainly on crustaceans (Ref. 1602). Also Ref. 9137, 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Protogyny unconfirmed (Ref. 84746).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echidna nebulosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTATTTAGTATTTGGCGCCTGAGCCGGAATGGTCGGCACTGCCTTGAGCCTCCTGATTCGGGCTGAACTTAGCCAGCCTGGCGCTCTTTTAGGAGACGACCAAATCTACAACGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATACCCGTTATAATTGGGGGGTTCGGGAACTGACTCATCCCATTAATGATTGGGGCTCCTGACATGGCCTTCCCGCGGATAAACAACATAAGCTTCTGGCTACTCCCACCATCATTCCTTCTCCTGCTAGCGTCCTCCGGCGTAGAGGCGGGTGCAGGAACCGGATGAACTGTCTACCCCCCTCTTGCAGGAAATCTAGCCCATGCCGGGGCATCCGTTGACCTAACTATCTTCTCCCTCCACCTGGCAGGGGTGTCTTCAATCCTGGGGGCAATTAACTTTATTACAACAATTATTAACATGAAACCCCCAGCCATTACACAATATCAAACACCTTTATTTGTTTGAGCGGTCCTCGTTACGGCCGTACTCCTACTGCTCTCTCTTCCTGTCCTAGCTGCCGGCATTACAATGCTTTTAACCGATCGTAACCTTAACACCACATTCTTTGACCCTGCTGGTGGAGGAGACCCAATTCTTTATCAACATCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Echidna nebulosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 58
Specimens with Barcodes: 68
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Snowflake moray

The snowflake moray, Echidna nebulosa, also known as the clouded moray is a moray eel of the family Muraenidae, found in the Indo-Pacific oceans and throughout Micronesia. The species is also found in the eastern Central Pacific from southern Baja California, Mexico, and from Costa Rica to northern Colombia, at depths of between 2 and 30 metres (7 and 100 ft). Its length is up to one metre.

In the aquarium

The snowflake moray eel is a very commonly kept saltwater eel. They are very hardy and well-suited to life within an aquarium. Up to 36" in length (while 28" is more common in captivity), the snowflake moray eel requires an aquarium that is larger than 20 gallons (40–50 gallons when full grown) with a tight-fitting lid, as these eels (and all eels, for that matter) are good at escaping and can fit through surprisingly small holes in aquarium lids. The snowflake eel has been known to live to 4 years and older in captivity. They are carnivores, readily accepting just about any meaty foods, including krill, shrimp, silversides and octopus meat. Unless already acclimated to frozen foods, the moray eel will likely need to be fed with live ghost shrimp when first acquired. Weaning can be accomplished over time. The feeding of freshwater feeder fish (goldfish, rosy reds, etc.) will likely cause liver disease if fed to the eel, so such feeding should be avoided.

The snowflake moray eel is not safe to keep with shrimp, crabs or lobsters, since crustaceans are their natural diet. However, they are safe to keep with most other invertebrates, including starfish, anemones and sea urchins. Snowflake morays are reef safe and will not bother corals, though these eels are messy eaters and will require strong filtration and a relatively large protein skimmer for the long-term health of any corals housed in their aquarium. The moray eel will likely consume very small fish; therefore, one should think twice before keeping a snowflake eel with small fish such as damselfish. Compatible tankmates for the snowflake moray eel include other relatively large, aggressive fish, such as lionfish, tangs, triggerfish, wrasses, and possibly even other snowflake moray eels if they are both introduced to the tank at the same time.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!