Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found between rocks and corals of intertidal reef flats, also in shallow lagoon and seaward reefs to depths of at least 10 m (Ref. 9710, 58302). Are benthic (Ref. 58302). Feed mainly on crustaceans. Protogynous hermaphroditism unconfirmed for this species (Ref. 84746). Safely kept with small aquarium fishes (Ref. 9710). Solitary, seen usually in the open or with only head exposed (Ref 90102).
  • Chen, H.-M., K.-T. Shao and C.T. Chen 1994 A review of the muraenid eels (Family Muraenidae) from Taiwan with descriptions of twelve new records. Zool. Stud. 33(1):44-64. (Ref. 6934)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: moray (English), morena (Espanol)
 
Echidna nebulosa (Ahl, 1789)


Starry moray,     Snowflake moray



Snout short and jaws short, broad; front nostril tubular, rear one a small hole above front of eye; no canine teeth;  molar-like teeth on roof of mouth, short stout conical teeth at front of jaws; side of jaws with 1-2 rows of small close-set compressed nodular teeth; length of tail very slightly greater than ½ TL; gill opening a small slit at mid-flank; dorsal and anal fins skin covered, but evident; dorsal origin before gill opening,  anal origin immediately after anus; tip of tail blunt, with a skin-covered fin.



White, with two rows of dendritic black blotches containing small yellow spots, these blotches sometimes forming more or less complete bars on head region; numerous small black spots between large blotches; front nostrils yellow.

Size: to 80 cm.

Habitat: rocky and rubble bottoms.

Depth: 1-30 m.

Widespread in the tropical Indo-Pacific from East Africa to the Americas; the  mouth of the Gulf of California to Colombia, and all the oceanic islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (Ref. 33390) to the Society Islands, north to southern Japan and the Hawaiian Islands, south to Lord Howe Island; throughout Micronesia. Eastern Central Pacific: southern Baja California, Mexico and from Costa Rica to northern Colombia (Ref. 9324). Also found in Southeast Atlantic.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Panama, north to Ryukyu Islands, Ogasawara Islands and Johnston Atoll, south to Western Australia and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 30 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0; Vertebrae: 119 - 126
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 80.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 48635))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body white with 2 rows of large dendritic black blotches; black spots between blotches become irregularly linear with age. Yellow eyes (Ref. 48635).Description: Characterized by body depth at gill opening 14-23 in TL; origin of dorsal fin above or slightly anterior to gill opening; anus near middle of body; without canine teeth; conical to rounded molariform jaw teeth; vomer with rounded molariform teeth in two rows that diverge anteriorly in large individuals (Ref. 90102).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Found between rocks and corals of intertidal reef flats, also in shallow lagoons and seaward reefs to depths of at least 10 m. Feeds mainly on crustaceans. Safely kept with small aquarium fishes (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 48 m (Ref. 58302), usually ? - 10 m (Ref. 30404)
  • Mundy, B.C. 2005 Checklist of the fishes of the Hawaiian Archipelago. Bishop Museum Bulletins in Zoology. Bishop Mus. Bull. Zool. (6):1-704. (Ref. 58302)
  • Kuiter, R.H. 1998 Photo guide to fishes of the Maldives. Atoll Editions, Victoria, Australia. 257 p. (Ref. 30404)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 78 specimens in 1 taxon.
Water temperature and chemistry ranges based on 56 samples.

Environmental ranges
  Depth range (m): 0.08 - 100
  Temperature range (°C): 17.033 - 29.336
  Nitrate (umol/L): 0.047 - 26.825
  Salinity (PPS): 32.938 - 35.924
  Oxygen (ml/l): 1.080 - 4.883
  Phosphate (umol/l): 0.083 - 2.088
  Silicate (umol/l): 0.974 - 14.896

Graphical representation

Depth range (m): 0.08 - 100

Temperature range (°C): 17.033 - 29.336

Nitrate (umol/L): 0.047 - 26.825

Salinity (PPS): 32.938 - 35.924

Oxygen (ml/l): 1.080 - 4.883

Phosphate (umol/l): 0.083 - 2.088

Silicate (umol/l): 0.974 - 14.896
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated. Echidna nebulosa =  Richardson, 1845 Floral moray. Attains 70 cm. East London to southern Mozambique, Indo-Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Estuary, Mangrove

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found between rocks and corals of intertidal reef flats, also in shallow lagoon and seaward reefs to depths of at least 10 m (Ref. 9710, 58302). Benthic (Ref. 58302). Occasionally leave the water & travel between tidal pools (Ref. 1602). Feeds on fish and crabs, mainly on crustaceans (Ref. 1602). Also Ref. 9137, 58534.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Protogyny unconfirmed (Ref. 84746).
  • Fishelson, L. 1992 Comparative gonad morphology and sexuality of the Muraenidae (Pisces, Teleostei). Copeia 1992(1):197-209. (Ref. 32169)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echidna nebulosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTATTTAGTATTTGGCGCCTGAGCCGGAATGGTCGGCACTGCCTTGAGCCTCCTGATTCGGGCTGAACTTAGCCAGCCTGGCGCTCTTTTAGGAGACGACCAAATCTACAACGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATACCCGTTATAATTGGGGGGTTCGGGAACTGACTCATCCCATTAATGATTGGGGCTCCTGACATGGCCTTCCCGCGGATAAACAACATAAGCTTCTGGCTACTCCCACCATCATTCCTTCTCCTGCTAGCGTCCTCCGGCGTAGAGGCGGGTGCAGGAACCGGATGAACTGTCTACCCCCCTCTTGCAGGAAATCTAGCCCATGCCGGGGCATCCGTTGACCTAACTATCTTCTCCCTCCACCTGGCAGGGGTGTCTTCAATCCTGGGGGCAATTAACTTTATTACAACAATTATTAACATGAAACCCCCAGCCATTACACAATATCAAACACCTTTATTTGTTTGAGCGGTCCTCGTTACGGCCGTACTCCTACTGCTCTCTCTTCCTGTCCTAGCTGCCGGCATTACAATGCTTTTAACCGATCGTAACCTTAACACCACATTCTTTGACCCTGCTGGTGGAGGAGACCCAATTCTTTATCAACATCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Echidna nebulosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 59
Specimens with Barcodes: 70
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
  • Castle, P.H.J. 1984 Muraenidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Volume. 1. FAO, Rome. (Ref. 3258)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Snowflake moray

The snowflake moray, Echidna nebulosa, also known as the clouded moray among many various vernacular names, is a species of marine fish of the family Muraenidae.[2]

It is widespread throughout the Indo-Pacific area from the eastern coast of Africa throughout Micronesia including the Red Sea and Hawaii.[3] The species is also found in the eastern Central Pacific from southern Baja California, Mexico, and from Costa Rica to northern Colombia.[4]

This species reaches a length of 100 centimetres (39 in) but its common size is 50 centimetres (20 in). It lives at depths of between 2 and 30 metres (7 and 100 ft).[3][5]

In the aquarium[edit]

The snowflake moray is a very commonly kept saltwater eel. They are very hardy and well-suited to life within an aquarium. Up to 28" in length in captivity, the snowflake moray requires an aquarium that is larger than 20 gallons (40–50 gallons when full grown) with a tight-fitting lid, as these eels (and all eels, for that matter) are good at escaping and can fit through surprisingly small holes in aquarium lids. The snowflake eel has been known to live to 4 years and older in captivity. They are carnivores, readily accepting just about any meaty foods, including krill, shrimp, silversides and octopus meat. Unless already acclimated to frozen foods, the moray eel will likely need to be fed with live ghost shrimp when first acquired. Weaning can be accomplished over time. The feeding of freshwater feeder fish (goldfish, rosy reds, etc.) will likely cause liver disease if fed to the eel, so such feeding should be avoided.[6]

The snowflake moray eel is not safe to keep with shrimp, crabs or lobsters, since crustaceans are their natural diet. However, they are safe to keep with most other invertebrates, including starfish, anemones and sea urchins. Snowflake morays are reef safe and will not bother corals, though these eels are messy eaters and will require strong filtration and a relatively large protein skimmer for the long-term health of any corals housed in their aquarium. The moray eel will likely consume very small fish such as damselfish. Compatible tankmates for the snowflake moray eel include other relatively large, aggressive fish, such as lionfish, tangs, triggerfish, wrasses, and possibly even other snowflake moray eels if they are both introduced to the tank at the same time.[6]

References[edit]

  1. ^ Nicolas Bailly (2013). Nicolas Bailly, ed. "Echidna nebulosa (Ahl, 1789)". FishBase. World Register of Marine Species. Retrieved October 18, 2013. 
  2. ^ http://www.fishbase.org/comnames/CommonNamesList.php?ID=5388&GenusName=Echidna&SpeciesName=nebulosa&StockCode=5647
  3. ^ a b http://www.fishbase.org/summary/5388
  4. ^ McCosker, J.E. and R.H. Rosenblatt, 1995. Muraenidae. Morenas. p. 1303-1315. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome.
  5. ^ http://fran.cornu.free.fr/affichage/affichage_nom.php?id_espece=808#
  6. ^ a b http://www.aquaticcommunity.com/sw/snowflakemorayeel.php
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!