Overview
Comprehensive Description
Biology
Inhabit coastal waters (Ref. 30573, 44894), usually entering estuaries (Ref. 44894). Abundant in shallow water and often caught at the surf-line or in rock pools (Ref. 9987). Larger, solitary fish sometimes enter brackish mangrove areas (Ref. 9987). Juveniles in estuaries move into deeper water with growth (Ref. 4335). Often in schools (Ref. 9710). Feed on benthic invertebrates, mainly mollusks (Ref. 5213) and aquatic macrophytes (Ref. 26055). Popular angling species commonly captured with hook and line (Ref. 44894). Marketed fresh (Ref. 5284).
-
Bauchot, M.-L. and M.M. Smith 1984 Sparidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). volume 4. [var. pag.] FAO, Rome. (Ref. 3507)
http://www.fishbase.org/references/FBRefSummary.php?id=3507&speccode=4543
Trusted
Distribution
Indo-West Pacific: Red Sea and East Africa to Japan, China, and Australia.
-
Bauchot, M.-L. and P.H. Skelton 1986 Sparidae. p. 331-332. In J. Daget, J.-P. Gosse and D.F.E. Thys van den Audenaerde (eds.) Check-list of the freshwater fishes of Africa (CLOFFA). ISNB, Brussels; MRAC, Tervuren; and ORSTOM, Paris. Vol. 2. (Ref. 4335)
http://www.fishbase.org/references/FBRefSummary.php?id=4335&speccode=5526
Trusted
Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Seychelles, Somalia, South Africa (country), Tanzania
-
MacNae, W. & M. Kalk (eds) (1958). A natural history of Inhaca Island, Mozambique. Witwatersrand Univ. Press, Johannesburg. I-iv, 163 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6266
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Randall, J.E. (1992). Red Sea Reef Fishes. Immel Publishing.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6091
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Smith, J.L.B. & M.M. Smith (1963). The fishes of Seychelles. Department of Ichthyology, Rhodes University. Grahamstown.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5926
Trusted
Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Philippines, north to southern Japan, south to northern Australia.
Trusted
Physical Description
Morphology
Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 13; Analspines: 3; Analsoft rays: 10 - 11
-
Heemstra, P.C. 1995 Additions and corrections for the 1995 impression. p. v-xv. In M.M. Smith and P.C. Heemstra (eds.) Revised Edition of Smiths' Sea Fishes. Springer-Verlag, Berlin. (Ref. 11228)
http://www.fishbase.org/references/FBRefSummary.php?id=11228&speccode=506
Trusted
Size
Max. size
80.0 cm TL (male/unsexed; (Ref. 3678)); max. published weight: 12.0 kg (Ref. 1724)
-
Torres, F.S.B. Jr. 1991 Tabular data on marine fishes from Southern Africa, Part I. Length-weight relationships. Fishbyte 9(1):50-53. (Ref. 3678)
http://www.fishbase.org/references/FBRefSummary.php?id=3678&speccode=1315
-
Carcasson, R.H. 1977 A field guide to the coral reef fishes of the Indian and West Pacific Oceans. William Collins Sons & Co. Ltd, Glasgow. 320 p. (Ref. 1724)
http://www.fishbase.org/references/FBRefSummary.php?id=1724&speccode=5368
Trusted
Diagnostic Description
Bright yellow mark above the pelvic base.
-
Heemstra, P.C. 1995 Additions and corrections for the 1995 impression. p. v-xv. In M.M. Smith and P.C. Heemstra (eds.) Revised Edition of Smiths' Sea Fishes. Springer-Verlag, Berlin. (Ref. 11228)
http://www.fishbase.org/references/FBRefSummary.php?id=11228&speccode=506
Trusted
Description
Inhabits coastal waters. Abundant in shallow water and often caught at the surf-line or in rock pools (Ref. 9987). Larger, solitary fish sometimes enter brackish mangrove areas (Ref. 9987). Juveniles in estuaries move into deeper water with growth (Ref. 4335). Feeds on benthic invertebrates, mainly molluscs (Ref. 5213). Also caught using longlines. Generally marketed fresh (Ref. 5284).
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range ? - 60 m (Ref. 30573)
-
Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
http://www.fishbase.org/references/FBRefSummary.php?id=30573&speccode=17471
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 0.2 - 15
Temperature range (°C): 21.061 - 26.857
Nitrate (umol/L): 0.462 - 1.956
Salinity (PPS): 34.532 - 35.349
Oxygen (ml/l): 4.572 - 5.197
Phosphate (umol/l): 0.380 - 0.384
Silicate (umol/l): 2.568 - 5.808
Graphical representation
Depth range (m): 0.2 - 15
Temperature range (°C): 21.061 - 26.857
Nitrate (umol/L): 0.462 - 1.956
Salinity (PPS): 34.532 - 35.349
Oxygen (ml/l): 4.572 - 5.197
Phosphate (umol/l): 0.380 - 0.384
Silicate (umol/l): 2.568 - 5.808
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 0.2 - 15
Temperature range (°C): 21.061 - 26.857
Nitrate (umol/L): 0.462 - 1.956
Salinity (PPS): 34.532 - 35.349
Oxygen (ml/l): 4.572 - 5.197
Phosphate (umol/l): 0.380 - 0.384
Silicate (umol/l): 2.568 - 5.808
Graphical representation
Depth range (m): 0.2 - 15
Temperature range (°C): 21.061 - 26.857
Nitrate (umol/L): 0.462 - 1.956
Salinity (PPS): 34.532 - 35.349
Oxygen (ml/l): 4.572 - 5.197
Phosphate (umol/l): 0.380 - 0.384
Silicate (umol/l): 2.568 - 5.808
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 0 - 60m.
Recorded at 60 meters.
Habitat: demersal. Natal stumpnose. (Forsskal, 1775) Attains 80 cm. but averages 40 cm. Red Sea and tropical Indo-West Pacific region. Fairly abundant in Natal waters. Flesh excellent. Easily recognisable by the bright yellow curved mark up and back from the V base. ( Pelvic Ventral fin ).
Recorded at 60 meters.
Habitat: demersal. Natal stumpnose. (Forsskal, 1775) Attains 80 cm. but averages 40 cm. Red Sea and tropical Indo-West Pacific region. Fairly abundant in Natal waters. Flesh excellent. Easily recognisable by the bright yellow curved mark up and back from the V base. ( Pelvic Ventral fin ).
Trusted
Migration
Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Trophic Strategy
Inhabits coastal waters (Ref. 30573), and sandy areas (Ref. 9137). Abundant in shallow water and often caught at the surf-line or in rock pools (Ref. 9987). Larger, solitary fish sometimes enter brackish mangrove areas (Ref. 9987). Juveniles in estuaries move into deeper water with growth (Ref. 4335). Feeds on benthic invertebrates, mainly mollusks (Ref. 5213); also on crabs and worms (Ref. 9137) and aquatic macrophytes (Ref. 26055).
-
van der Elst, R.P. and F. Adkin (eds.) 1991 Marine linefish: priority species and research objectives in southern Africa. Oceanogr. Res. Inst., Spec. Publ. No.1. 132 p. (Ref. 4332)
http://www.fishbase.org/references/FBRefSummary.php?id=4332&speccode=288
Trusted
Life History and Behavior
Life Cycle
Also Ref. 28504.
-
van der Elst, R.P. and F. Adkin (eds.) 1991 Marine linefish: priority species and research objectives in southern Africa. Oceanogr. Res. Inst., Spec. Publ. No.1. 132 p. (Ref. 4332)
http://www.fishbase.org/references/FBRefSummary.php?id=4332&speccode=288
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Rhabdosargus sarba
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 18 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 18 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACTGCCTTAAGCCTGCTCATTCGAGCCGAACTAAGCCAGCCTGGCGCTCTCCTTGGAGACGATCAGATTTACAATGTTATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGGGGGTTTGGAAACTGATTAATCCCACTTATGATTGGDGCCCCTGACATAGCAWTCCCTCGAATAAATAACATAAGCTTCTGACTGCTTCCCCCCTCATTTCTCCTCCTGTTAGCTTCTTCCGGAGTTGAAGCCGGGGCCGGCACTGGATGAACAGTTTACCCTCCCCTAGCAGGCAATCTCGCCCACGCAGGTGCATCAGTTGATTTAACAATCTTTTCCCTTCATTTGGCCGGAATTTCATCCATTCTTGGTGCCATTAACTTCATCACTACAATTATCAACATGAAGCCCCCGGCTATTTCACAGTACCAAACACCACTCTTCGTTTGGGCCGTTCTAATTACCGCCGTCCTGCTTCTTTTATCTCTTCCGGTTCTTGCTGCCGGAATTACGATGCTCCTCACAGATCGAAACCTAAACACCACCTTCTTCGACCCAGCCGGAGGAGGGGACCCAATTCTTTATCAGCACCTATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Rhabdosargus sarba
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 34
Species With Barcodes: 1
Public Records: 19
Specimens with Barcodes: 34
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial; aquaculture: commercial; gamefish: yes
-
Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
http://www.fishbase.org/references/FBRefSummary.php?id=12108&speccode=4683
-
Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
http://www.fishbase.org/references/FBRefSummary.php?id=4931&speccode=228
-
Frimodt, C. 1995 Multilingual illustrated guide to the world's commercial warmwater fish. Fishing News Books, Osney Mead, Oxford, England. 215 p. (Ref. 9987)
http://www.fishbase.org/references/FBRefSummary.php?id=9987&speccode=2534
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


