Overview

Comprehensive Description

Biology

Inhabit coastal waters (Ref. 30573, 44894), usually entering estuaries (Ref. 44894). Abundant in shallow water and often caught at the surf-line or in rock pools (Ref. 9987). Larger, solitary fish sometimes enter brackish mangrove areas (Ref. 9987). Juveniles in estuaries move into deeper water with growth (Ref. 4335). Often in schools (Ref. 9710). Feed on benthic invertebrates, mainly mollusks (Ref. 5213) and aquatic macrophytes (Ref. 26055). Popular angling species commonly captured with hook and line (Ref. 44894). Marketed fresh (Ref. 5284).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to Japan, China, and Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Philippines, north to southern Japan, south to northern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 13; Analspines: 3; Analsoft rays: 10 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

80.0 cm TL (male/unsexed; (Ref. 3678)); max. published weight: 12.0 kg (Ref. 1724)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Bright yellow mark above the pelvic base.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits coastal waters. Abundant in shallow water and often caught at the surf-line or in rock pools (Ref. 9987). Larger, solitary fish sometimes enter brackish mangrove areas (Ref. 9987). Juveniles in estuaries move into deeper water with growth (Ref. 4335). Feeds on benthic invertebrates, mainly molluscs (Ref. 5213). Also caught using longlines. Generally marketed fresh (Ref. 5284).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range ? - 60 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0.2 - 15
  Temperature range (°C): 21.061 - 26.857
  Nitrate (umol/L): 0.462 - 1.956
  Salinity (PPS): 34.532 - 35.349
  Oxygen (ml/l): 4.572 - 5.197
  Phosphate (umol/l): 0.380 - 0.384
  Silicate (umol/l): 2.568 - 5.808

Graphical representation

Depth range (m): 0.2 - 15

Temperature range (°C): 21.061 - 26.857

Nitrate (umol/L): 0.462 - 1.956

Salinity (PPS): 34.532 - 35.349

Oxygen (ml/l): 4.572 - 5.197

Phosphate (umol/l): 0.380 - 0.384

Silicate (umol/l): 2.568 - 5.808
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 60m.
Recorded at 60 meters.

Habitat: demersal. Natal stumpnose.  (Forsskal, 1775)  Attains 80 cm. but averages 40 cm. Red Sea and tropical Indo-West Pacific region. Fairly abundant in Natal waters. Flesh excellent. Easily recognisable by the bright yellow curved mark up and back from the V base. ( Pelvic Ventral fin ).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coastal waters (Ref. 30573), and sandy areas (Ref. 9137). Abundant in shallow water and often caught at the surf-line or in rock pools (Ref. 9987). Larger, solitary fish sometimes enter brackish mangrove areas (Ref. 9987). Juveniles in estuaries move into deeper water with growth (Ref. 4335). Feeds on benthic invertebrates, mainly mollusks (Ref. 5213); also on crabs and worms (Ref. 9137) and aquatic macrophytes (Ref. 26055).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Also Ref. 28504.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhabdosargus sarba

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACTGCCTTAAGCCTGCTCATTCGAGCCGAACTAAGCCAGCCTGGCGCTCTCCTTGGAGACGATCAGATTTACAATGTTATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGGGGGTTTGGAAACTGATTAATCCCACTTATGATTGGDGCCCCTGACATAGCAWTCCCTCGAATAAATAACATAAGCTTCTGACTGCTTCCCCCCTCATTTCTCCTCCTGTTAGCTTCTTCCGGAGTTGAAGCCGGGGCCGGCACTGGATGAACAGTTTACCCTCCCCTAGCAGGCAATCTCGCCCACGCAGGTGCATCAGTTGATTTAACAATCTTTTCCCTTCATTTGGCCGGAATTTCATCCATTCTTGGTGCCATTAACTTCATCACTACAATTATCAACATGAAGCCCCCGGCTATTTCACAGTACCAAACACCACTCTTCGTTTGGGCCGTTCTAATTACCGCCGTCCTGCTTCTTTTATCTCTTCCGGTTCTTGCTGCCGGAATTACGATGCTCCTCACAGATCGAAACCTAAACACCACCTTCTTCGACCCAGCCGGAGGAGGGGACCCAATTCTTTATCAGCACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhabdosargus sarba

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!