Overview

Comprehensive Description

Biology

Occur in lakes, ponds and pools of small to large rivers (Ref. 5723, 10294). Juveniles feed on small invertebrates such as cladocerans, copepods, and midge larvae. Adults are piscivorous, consuming shad, silversides, and occasional young sunfish (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

White bass are found in many parts of central North America. Originally they only existed in the Great Lakes and the Mississippi River, but because of introductions they are now most common in the Mississippi, Missouri and Ohio rivers.

Biogeographic Regions: nearctic (Native )

  • Etnier, D., W. Starnes. 2001. The Fishes of Tennessee. Knoxville: The University of Tennessee Press.
  • Quist, M., C. Guy, R. Bernot, J. Stephen. 2002. Ecology of larval White Bass in a large Kansas Reservoir. North American Journal of Fisheries Management, Volume 22 Issue 2: 637-642.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: St. Lawrence-Great Lakes, Hudson Bay (Red River) and Mississippi River basins from Quebec to Manitoba in Canada and south to Louisiana in USA; and from Mississippi River in Louisiana to Rio Grande in Texas and New Mexico, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is native to the St. Lawrence-Great Lakes, Hudson Bay (Red River), and Mississippi River basins from Quebec to Manitoba and south to Louisiana; Gulf Slope drainages from Mississippi River, Louisiana, to Rio Grande, Texas and New Mexico (Page and Burr 1991). It has been introduced widely within and outside its natural range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Morone chrysops (white bass) can be seen in many parts of North America. Its range extends from southern Canada to northeastern Mexico following a path roughly between the Mississippi River system and the Appalachian Mountains. Notable abundance of the species is located primarily in the Mississippi, Missouri, and Ohio River drainages. Historically, it was found only in the Great Lakes and Mississippi River drainages, but it has been widely introduced outside of these areas.

Biogeographic Regions: nearctic (Native )

  • Etnier, D., W. Starnes. 2001. The Fishes of Tennessee. Knoxville: The University of Tennessee Press.
  • Quist, M., C. Guy, R. Bernot, J. Stephen. 2002. Ecology of larval White Bass in a large Kansas Reservoir. North American Journal of Fisheries Management, Volume 22 Issue 2: 637-642.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) This species is native to the St. Lawrence-Great Lakes, Hudson Bay (Red River), and Mississippi River basins from Quebec to Manitoba and south to Louisiana; Gulf Slope drainages from Mississippi River, Louisiana, to Rio Grande, Texas and New Mexico (Page and Burr 1991). It has been introduced widely within and outside its natural range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern and central U.S.A., southern Canada, introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult white bass can be as long as 46 cm (18 inches), and can weigh up to 3.2 kg (7 pounds). Females are often larger than males. White bass are silvery gray in color, and the belly is always lighter than the back. They have many narrow stripes on their sides.

Range mass: 3.2 (high) kg.

Range length: 460 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The maximum length of Morone chrysops is about 46 cm (18 inches) and the maximum weight reaches around 3.2 kg (7 pounds). White bass are silvery gray fish with the belly and breast region being lighter (silver to white) and the dorsal region silver to black in color. They exhibit numerous narrow, uninterrupted, dark colored lines along their sides which are sometimes incomplete below the lateral line. They have a protruding lower mandible and the mouth extends to the middle of the eye. White bass have been recorded to be around 212 mm total length at one year, 364 mm at two years, 401 mm at three, and 426 mm at four. Females become larger than males on average.

Characteristics that enable more precise identification of the species include a lateral line count of 51 to 60 scales. Dorsal fin rays number 12 to 14 anal fin rays 11 to 13. This species has 20 to 25 gill rakers and its pectoral fins have 15 to 17 fin rays. Near the tip of the tongue, white bass have a noticeable tooth patch that lies in one fused or two barely separate areas of the tongue.

Range mass: 3.2 (high) kg.

Range length: 460 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 450 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

45.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 3,090 g (Ref. 4699); max. reported age: 9 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 42 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

White bass prefer to live in large bodies of water, such as deep lakes and large rivers, especially above dams. They do not like muddy water or areas with many plants.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is known from a range of habitat types including the open waters of large lakes and reservoirs, to the pools of slow-moving small and large rivers. This species is typically seen in schools at the water surface. During the day this species is seen offshore in the open waters of the lake, and at night it moves inshore. It displays an avoidance for areas of continuous turbidity. Spawning grounds are usually in the running water of tributary streams with rock or gravel substrate, or along lake shores with high wave action. Individuals tend to return to specific spawning grounds.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White bass are principally found in large bodies of water (i.e., deep lakes and unmuddied rivers). Reservoir systems have been shown to house higher populations compared to natural lakes and rivers. This species prefers areas of open water with little turbidity and where the substrate is clean and unvegetated. Lower abundances of white bass have shown to be in direct correlation with increasing amounts of vegetation.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.6 - 0.6
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes open waters of large lakes and reservoirs and pools of slow-moving small to large rivers. This species usually occurs in surface waters, roaming in schools. It tends to be offshore during the day, inshore at night. It generally avoids areas of continous turbidity. Running water of tributary streams appear to be preferred for spawning, but this fish may spawn along lake shores with high wave action. Spawning substrate is usually rock or gravel bottoms in water 0.6-3 meters deep; eggs sink and stick; individuals generally return to specific spawning areas. Information primarily from Becker (1983) and Moyle (1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate over 200 km to upstream spawning areas, but usually not that far (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Larval white bass eat mostly zooplankton, especially Daphnia species. Juveniles eat mostly invertebrates, such as Chironomidae, Ephemeroptera, Odonata, Zygoptera, Hemiptera, Amphipoda, and Cambaridae. Adults over 350 mm in size start to eat mostly fish. Common prey includes, Pimephales promelas, Etheostoma nigrum, Dorosoma cepedianum, Dorosoma petenense, Centrarchidae, Perca flavescens, Stizostedion canadense, Aplodinotus grunniens, Cyprinus carpio, Ameiurus, and others. White bass have up to 4 peaks in daily feeding activity, but this can change throughout the year.

Animal Foods: fish; insects; aquatic crustaceans; zooplankton

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in lakes, ponds and pools of small to large rivers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Larval white bass feed mostly on zooplankton, especially Daphnia species. As development proceeds, juveniles begin feeding on macro-invertebrates, such as chironomid larvae (Chironomidae), mayfly larvae (Ephemeroptera), dragonfly larvae (Odonata), damselfly larvae (Zygoptera), bugs (Hemiptera), amphipods (Amphipoda), and crayfish (Cambaridae). Adults, or fish over 350 mm, become highly piscivorous and begin feeding upon fish. Common prey includes, fathead minnows (Pimephales promelas), johnny darters (Etheostoma nigrum), gizzard shad (Dorosoma cepedianum), threadfin shad (Dorosoma petenense), young sunfish (Centrarchidae), yellow perch (Perca flavescens), saugers (Sander canadensis), freshwater drum (Aplodinotus grunniens), carp (Cyprinus carpio), bullhead species (Ameiurus), and others. When feeding, schools of white bass prey upon schools of feeder fish (various shad and minnow), causing the small, feeder fish to splash wildly at the surface as they try to escape. Anglers calle this the "jumps." Up to 4 peaks in daily feeding activity can occur, but this varies seasonally.

Animal Foods: fish; insects; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Visually oriented predator. Eats fishes, zooplankton, aquatic insects, oligochaetes, and crayfish; fishes often dominate diet of adults; diet may vary from place to place (Moyle 1976, Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

White bass are important as intermediate predators in the ecosystems in which they live, they are food for larger fish and other predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

White bass are easily preyed upon by many carnivorous fish species, including other white bass.

Known Predators:

  • white bass (Morone_chrysops)

  • Schultz, K. 2004. Field Guide to Freshwater Fish. Hoboken, New Jersey: John Wiley & Sons, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

White bass are important as intermediate predators in the ecosystems in which they live, they are food for larger fish and other predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

White bass are easily preyed upon by many carnivorous fish species, including other white bass.

Known Predators:

  • Schultz, K. 2004. Field Guide to Freshwater Fish. Hoboken, New Jersey: John Wiley & Sons, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Morone chrysops preys on:
Stizostedion vitreum

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 1,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Schools throughout year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

White bass use their lateral line systems to detect water movement and rely on vision and sensing chemical cues. Little is known about communication in this species.

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

White bass use their lateral line systems to detect water movement and rely on vision and sensing chemical cues. Little is known about interspecific communication in this species.

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

White bass eggs hatch take about two days to hatch. The young larvae quickly begin to form schools, just as adults do.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Assuming same mode of reproduction as in M. saxatilis.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

White bass eggs hatch about two days after fertilization. The young larvae quickly begin to show the schooling behavior seen in adults.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

White bass grow quickly and have high death rates. Northern and southern populations have different average lifespans. Typically, southern white bass live about 4 years while northern white bass can live 8 years. Some white bass have reached 14 years of age.

Range lifespan

Status: wild:
15 (high) years.

Typical lifespan

Status: wild:
4 (low) years.

Range lifespan

Status: captivity:
9 (high) years.

  • Willis, D., C. Paukert, B. Blackwell. 2002. Biology of White Bass in Eastern South Dakota Glacial Lakes. North American Journal of Fisheries Management, Volume 22 Issue 2: 627-636.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Morone chrysops exhibits rapid growth in conjunction with high natural mortality, resulting in a relatively short life. Although maturity is fairly similar in northern and southern populations, lifespan is not. Northern fish, on average, live longer than southern fish. Typically, southern white bass live about 4 years while northern white bass can live 8 years. Some white bass have reached 14 years of age.

Range lifespan

Status: wild:
15 (high) years.

Typical lifespan

Status: wild:
4 (low) years.

Range lifespan

Status: captivity:
9 (high) years.

  • Willis, D., C. Paukert, B. Blackwell. 2002. Biology of White Bass in Eastern South Dakota Glacial Lakes. North American Journal of Fisheries Management, Volume 22 Issue 2: 627-636.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild) Observations: In the wild, longevity is about 4 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

White bass swim to shallow water to breed. They do not build nests or form mating pairs. As a female lays her eggs, a group of males follows her, each trying to fertilize as many eggs as he can. Once the eggs are fertilized, the adults swim back to deep water.

Mating System: polyandrous

White bass breed when the water temperature reaches about 14 degrees celsius. This usually happens in February in the southern United States, and in May in the north. Each female lays around 500,000 eggs, which then sink and stick to the bottom. A group of males then fertilizes them. The eggs hatch about two days later. The young can grow to adulthood in as little as two years if they live in the south, but it can take much longer if they live in ther north.

Breeding interval: White bass annually breed in the spring

Breeding season: Spawning occurs from March through May

Range number of offspring: Up to 100's of thousands (high) .

Average time to hatching: 2 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Average time to hatching: 2 days.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Once they migrate to spawning grounds and the eggs are laid and fertilized, the adults abandon the eggs and return to deeper water.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Etnier, D., W. Starnes. 2001. The Fishes of Tennessee. Knoxville: The University of Tennessee Press.
  • Guy, C., R. Schultz, M. Colvin. 2002. Ecology and Management of White Bass. North American Journal of Fisheries Management, Volume 22 Issue 2: 606-608.
  • Quist, M., C. Guy, R. Bernot, J. Stephen. 2002. Ecology of larval White Bass in a large Kansas Reservoir. North American Journal of Fisheries Management, Volume 22 Issue 2: 637-642.
  • Gilbert, C., J. Williams. 2002. National Audubon Society Field Guide to Fishesl. New York, United States: Alfred A. Knopf, Inc..
  • Walden, H. 1964. Familiar Freshwater Fishes of America. New York, NY: Harper & Row, Publishers, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

River-dwelling white bass migrate upstream in search of tributaries to spawn, while lake-dwelling individuals search out stream inlets and shoreline to lay their eggs. As a female disperses her eggs, many males follow behind releasing their sperm with the intention of fertilizing as many of the eggs as possible. No elaborate courtship displays are practiced and no nests are built. Once spawning has taken place, breeding individuals return to deeper water.

Mating System: polyandrous

Spawning of Morone chrysops occurs as early as mid-February in the southern United States and as late as May in the more northern latitudes, or whenever water temperatures reach about 14-20 degrees celsius. White bass are polyandrous, and each female can lay up to and even over half a million eggs. Once the adhesive eggs are laid, they settle to the bottom and attach to the substrate to await fertilization by the males. Hatching occurs about 2 days after fertilization, with growth of the young being quite rapid. Sexual maturity is reached around 2 years after hatching in more southerly populations, while northern populations can take a significantly longer time to mature.

Breeding interval: White bass annually breed in the spring

Breeding season: Spawning occurs from March through May

Range number of offspring: Up to 100's of thousands (high) .

Average time to hatching: 2 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Average time to hatching: 2 days.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

White bass do not invest parental care beyond laying the eggs. Once they migrate to spawning grounds and the eggs are laid and fertilized, the adults abandon the eggs and return to deeper water to leave their offspring forcing them to fend for themselves.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Etnier, D., W. Starnes. 2001. The Fishes of Tennessee. Knoxville: The University of Tennessee Press.
  • Guy, C., R. Schultz, M. Colvin. 2002. Ecology and Management of White Bass. North American Journal of Fisheries Management, Volume 22 Issue 2: 606-608.
  • Quist, M., C. Guy, R. Bernot, J. Stephen. 2002. Ecology of larval White Bass in a large Kansas Reservoir. North American Journal of Fisheries Management, Volume 22 Issue 2: 637-642.
  • Gilbert, C., J. Williams. 2002. National Audubon Society Field Guide to Fishesl. New York, United States: Alfred A. Knopf, Inc..
  • Walden, H. 1964. Familiar Freshwater Fishes of America. New York, NY: Harper & Row, Publishers, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns in spring; eggs hatch in 4.5 days at 14 C, 1 day at 26 C; normally first spawns at age I to III, depending on location and conditions; few survive to age IV; forms large schools near spawning areas (Moyle 1976, Becker 1983, Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Morone chrysops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTGTTTGGCGCTTGAGCTGGTATAGTGGGCACTGCTCTAAGCCTTCTTATTCGAGCAGAGCTAAGCCAACCGGGCGCCCTCCTTGGGGATGACCAAATCTACAACGTAATCGTTACCGCACATGCATTTGTAATGATCTTTTTTATAGTAATACCAATCATGATCGGAGGATTCGGAAACTGACTTATTCCACTAATAATTGGAGCACCTGATATAGCATTCCCCCGAATGAACAACATAAGTTTTTGACTACTTCCCCCATCCTTCCTTCTCCTCTTGGCTTCTTCAGGCGTCGAAGCCGGGGCTGGGACTGGCTGAACCGTCTATCCCCCCCTTGCAAGCAACCTTGCACACGCAGGTGCATCTGTAGACTTAACAATTTTTTCTCTCCACCTGGCTGGGATCTCCTCAATTCTGGGGGCCATTAATTTCATCACAACTATTATTAACATGAAGCCTCCCGCTATTTCCCAGTACCAAACCCCCTTATTTGTCTGAGCTGTTCTAATTACAGCCGTCCTCTTACTTCTCTCTCTGCCAGTCCTCGCAGCCGGAATTACAATACTACTTACAGACCGAAATCTAAACACCACCTTCTTTGACCCTGCGGGGGGAGGGGACCCCATCCTCTACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Morone chrysops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

White bass are fairly common throughout their range, they are not listed on any conservation lists.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
NatureServe (G. Hammerson)

Reviewer/s
Woods, C. (Freshwater Fish Red List Authority), Collen, B., Dewhurst, N. & Ram, M. (Sampled Red List Index Coordinating Team)

Contributor/s

Justification
Morone chrysops has been assessed as Least Concern. This species has a broad distribution across the United States and Canada and occupies a range of habitat types. It has expanded its range and is increasing in abundance in areas. There are no known major threats reportedly impacting the population of this species, and therefore the population of this species is reported to be stable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not listed on any conservation lists, white bass are abundant where they occur. Unlike other species that may have minimum size limits and creel limits, many states do not impose size or creel limits for white bass caught inside their waterways. Of the states that do impose creel limits, they are typically very liberal. One potential problem with white bass populations is high variation of recruitment from year to year. The problem seems to revolve around the amount of precipitation for that year, but this has not been confirmed.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations): Total adult population size is unknown but presumably exceeds 1,000,000.

Abundance has increased in the lower Missouri River as a result of human-caused changes in the river (e.g. reservoir construction and consequent reductions in turbidity) (Pflieger and Grace 1987).

Warren et al. (2000) categorized the trend as "currently stable" in the southeastern United States.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Warren et al. (2000) categorized the trend as "currently stable" in the southeastern United States.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Abundance has increased in the lower Missouri River as a result of human-caused changes in the river (e.g, reservoir construction and consequent reductions in turbidity) (Pflieger and Grace 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no known major threats thought to be causing a significant decline in the population numbers of this species. In some areas of its range, it is under pressure for resources due to competition with the invasive species Morone americana. This species is also fished recreationally, however this does not appear to pose a significant threat to this species as it is described as growing in abundance in areas and expanding its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species-specific conservation measures in place, or needed, for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Morone_chrysops on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

White bass are popular with anglers and are considered good to eat.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

aquaculture: experimental; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Morone chrysops on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There is renewed angling interest in white bass. Their vigor when hooked has led to increasing popularity. They are also a popular food for consumption.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Sport fish, especially hybrids of white basS and striped bass in warm-water reservoirs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hybrid striped bass

A hybrid striped bass, also known as a wiper or whiterock bass, is a hybrid between the striped bass (Morone saxatilis) and the white bass (M. chrysops). It can be distinguished from the striped bass by broken rather than solid horizontal stripes on the body. Wipers are considered better suited for culture in ponds than either parent species because they are more resilient to extremes of temperature and to low dissolved oxygen.

Wipers became part of aquaculture in the United States in the late 1980s. Most producers purchase the fish young (as fry or fingerlings) and raise them in freshwater ponds. Currently about 10 million pounds (4.5 million kg) are produced annually in the United States. Wipers are used both as a gamefish and a food fish.

Most wipers are produced by fertilizing eggs from white bass with sperm from striped bass; the resulting fish are also called "sunshine bass" or "cherokee bass".

References [edit]

Hybrid striped bass are known for aggressive feeding habits which makes them highly sought after by anglers. Often schooling by the thousands, these stocked fish will surface feed on baitfish like shad. Often called "breaking," this surface feeding makes the fish visible and easy to catch on a wide array of lures and baits. Popular lures include casting spoons like Kastmaster and Little Cleo, buck-tail jigs, soft body plastic fish replicas, and inline spinners.

Their quality as a hard-fighting gamefish is closely followed by their delicious firm, white, flaky meat. Many restaurants sell "striped bass" on their menus, but what you are really eating when you order this are farm raised hybrid striped bass.

Origins are from 1970's when the first hybrids were stocked in Cherokee Lake in Tennessee. They became known as Cherokee bass, but most commonly are called 'hybrid' (Southeast) or 'wiper' (midwest and Texas). They are stocked in dozens of large impoundments to control baitfish populations and provide sport for anglers.

Produced in hatcheries, the most common hybridization is the female striped bass Morone saxatilis and the male white bass M. Chrysops. This is due to the high number of eggs produced by the female striped bass. This hybrid cross typically produces a faster growing offspring which attains larger size. The female striped bass is injected with human gonadotropin which stimulates her to lay. Usually there are around a dozen male white bass in the tank when the spawn occurs. Once the eggs are fertilized, the brood fish are removed and the eggs must stay adrift in artificial current for approximately 48 hours to hatch. Natural hybridization has been occurring for thousands of years between the species, but it is usually the reverse cross which would be male saxatilis x female chrysops since the white bass eggs do not require the same degree of flotating to hatch.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

White bass

The white bass or sand bass (Morone chrysops) is a freshwater fish of the temperate bass family Moronidae. It is the state fish of Oklahoma.

Contents

Range [edit]

White bass are distributed widely across the United States, particularly in the midwest. They are very abundant in Pennsylvania and the area around Lake Erie. Some native ranges of the white bass are the Arkansas River, Lake Erie near Cleveland, Ohio, and Lake Poinsett in South Dakota,also very abundant in Oklahoma [1] White bass have also been found in rivers that flow to the Mississippi. Native to many northern habitats, they have been introduced in many different waters around the United States, particularly in southern locations. They were also successfully introduced to Manitoba starting in the 1960s, where they have gained importance as a sport fish.

Physical description [edit]

The species' main color is silver-white to pale green. Its back is dark, with white sides and belly, and with narrow dark stripes running lengthwise on the sides. It has large, rough scales and two dorsal fins. The more anterior dorsal fin is much harder and appears to have spines on them. Although these are not true spines, this type of fin is called a spinous ray. The more posterior of the two dorsal fins is much softer, and is thus called a soft-ray. Because the vertebrae don't extend into the tail, the white bass has what is called a homocercal tail. The body is deep and compressed laterally.[2] Most grow to a length of between 10 and 12 inches, though they can reach 17 inches or more. Because the dorsal and ventral portions of the its tail angle inward toward a point to create a clear angle, the tail is said to be notched.

The record size for White bass caught on fishing tackle is six pounds and 13 oz (3.09 kg) shared by fish caught in 1989 in Orange Lake, Orange, Virginia and in 2010 in Amite River, Louisiana.[3]

Diet [edit]

White bass are carnivores. They have four main taxa in their diet: calanoid copepods, cyclopoid copepods, daphnia, and leptodora.[4] They are visual feeders. When not frightened, they will bite readily at live bait such as worms and minnows. Only the largest fish will feed on other fish, and as the summer season progresses, there is an overall trend towards eating fewer fish.[4] Fish that are able to accumulate lipids over the summer are better able to survive cold winters. When looking at midwestern white bass, particularly in South Dakota, diet overlap occurs between the bass and the walleye. As seasons progress through the summer and fall, the amount of diet overlap decreases as a result of both fish increasing in length.[5]

Habitat [edit]

White bass inhabit large reservoirs and rivers. When mating in the spring, they are more often found in shallow rivers, creeks, and streams.[6] White bass are found in high densities in the upstream segment of rivers. This portion of the river becomes the most degraded, as there are a number of different kinds of fish that live in this segment as well.[7]

Reproduction [edit]

The spawning season for the white bass is mid-March to late May. The optimal water temperatures are 12 to 20 degrees Celsius. They are known to find their home spawning ground even if it's moved to a different part of the same lake.[8] They like to spawn in moving water in a tributary stream, but they will spawn in windswept lake shores.[8] They spawn during daylight. Females release 242,000 to 933,000 eggs which stick to the surface of objects.[8] Eggs are laid in clear, relatively shallow water on plants, submerged logs, gravel, or rocks.[9] The parents move to deeper water and do not care for the young fish. The young fish live in shallow water for a while until they move to deeper water.[8]

When trying to find a female with whom to mate, males will bump against a female's abdominal area. The female will then rise closer to the surface and begin spinning and releasing eggs. Several males who have stayed in the area will be able to fertilize the eggs the female releases.[10]

Human importance and conservation [edit]

Fishermen have been known to fish from the shore, wade into rivers, or use small boats when it is possible. The best lures and baits to use include live minnows as well as different colored twister tails.[11] Check with your local DNR for limits, although common limits for white bass are 25 per day per person.

References [edit]

  1. ^ "Biology of White Bass in Eastern South Dakota Glacial Lakes". North American Journal of Fisheries Management 22 (2): 627–636. May 2002. 
  2. ^ "Temperate Basses". Pennsylvania Fish and Boat Commission. Commonwealth of Pennsylvania. Retrieved 26 April 2011. 
  3. ^ http://www.wrec.igfa.org/WRecordsList.aspx?lc+AllTackle&cn=Bass, white, accessed 27 Mar 2013
  4. ^ a b "The influence of diet, consumption, and lipid use on recruitment of white bass". Lakes and Reservoirs: Research and Management 9 (2): 133–141. June 2004. Retrieved 26 April 2011. 
  5. ^ "Biology of White Bass in Eastern South Dakota Glacial Lakes". North American Journal of Fisheries Management 22 (2): 627–636. 2002. 
  6. ^ "Texas Weekend Angler". Retrieved 3 May 2011. 
  7. ^ "Macrohabitat associations of fishes in shallow waters of the Detroit River". Journal of Fish Biology 76 (3): 446–466. Feb. 2010. 
  8. ^ a b c d University of Wisconsin Sea Grant Institute; February 2, 2006; Retrieved June 5, 2008
  9. ^ "Texas Freshwater Fishes". Retrieved 3 May 2011. 
  10. ^ Assessment of Balon’s reproductive guilds with application to Midwestern North American Freshwater Fishes. CRC Press. 1999. ISBN 978-0-8493-4007-9. 
  11. ^ "White Bass Fishing Forecast for 2011". Ohio Department of Natural Resources. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly placed in the genus Roccus. Electrophoretic studies indicate that distinct subpopulations may exist within even a single lake (see Lee et al. 1980). Hybrids of white bass and striped bass (called wipers) have been stocked in some areas. The family Percichthyidae was recognized by Robins et al. (1991) as possibly polyphyletic but was retained for convenience.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!