Overview

Comprehensive Description

Biology

Found on sand or mud bottoms. Associated with Sargassum (Ref. 26340). Adults feed on benthic invertebrates (Ref. 5377). Edible but generally rejected by fishers (Ref. 5377).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Nova Scotia, Bermuda and northern Gulf of Mexico to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to Uruguay (Ref. 47377). Eastern Atlantic: Canary Islands to Angola (Ref. 3592).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western and eastern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to Brazil, including the Bahamas, Caribbean and Antilles. Canary Islands to Angola.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Harmelin-Vivien, M. L. and J. C. Qu?, 1990; Claro, R., 1994; Maigret, J. and B. Ly, 1986; Breine, J. J., D. Nguenga, G. G. Teugels and F. Ollevier, 1996; Robins, C. R. and G. C. Ray, 1986; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 29 - 35; Analspines: 0; Analsoft rays: 30 - 35
  • Uyeno, T., K. Matsuura and E. Fujii (eds.) 1983 Fishes trawled off Suriname and French Guiana. Japan Marine Fishery Resource Research Center, Tokyo, Japan. 519 p. (Ref. 13608)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

27.5 cm TL (male/unsexed; (Ref. 36453))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 254 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 27.5 cm NG (male/unsexed).
  • Bigelow, H. B. and Schroeder, W. C., 1953; Harmelin-Vivien, M. L. and J. C. Qu?, 1990; Claro, R., 1994; Maigret, J. and B. Ly, 1986; Breine, J. J., D. Nguenga, G. G. Teugels and F. Ollevier, 1996; Robins, C. R. and G. C. Ray, 1986; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found to depths of 80m on sand or mud bottoms.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 293 m (Ref. 5951)
  • Scott, W.B. and M.G. Scott 1988 Atlantic fishes of Canada. Can. Bull. Fish. Aquat. Sci. 219:731 p. (Ref. 5951)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2981 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1671 samples.

Environmental ranges
  Depth range (m): 0 - 1442
  Temperature range (°C): 0.713 - 26.979
  Nitrate (umol/L): 0.115 - 22.089
  Salinity (PPS): 31.513 - 37.286
  Oxygen (ml/l): 3.350 - 7.576
  Phosphate (umol/l): 0.046 - 1.564
  Silicate (umol/l): 0.756 - 16.288

Graphical representation

Depth range (m): 0 - 1442

Temperature range (°C): 0.713 - 26.979

Nitrate (umol/L): 0.115 - 22.089

Salinity (PPS): 31.513 - 37.286

Oxygen (ml/l): 3.350 - 7.576

Phosphate (umol/l): 0.046 - 1.564

Silicate (umol/l): 0.756 - 16.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 80m.
Recorded at 80 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; marine; depth to 80 m. Associated with sandy or muddy bottoms, and with Sargassum
  • Bigelow, H. B. and Schroeder, W. C., 1953; Harmelin-Vivien, M. L. and J. C. Qu?, 1990; Claro, R., 1994; Maigret, J. and B. Ly, 1986; Breine, J. J., D. Nguenga, G. G. Teugels and F. Ollevier, 1996; Robins, C. R. and G. C. Ray, 1986; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Nibbler which is an opportunistic species that search the substrate to bite at larger items or pick up small items, either animals or plants. They occasionally engage in fin-biting or scale-eating of other fishes, and even scavenge (Ref. 40396). See Ref. 42268.
  • Adams, S.M. 1976 Feeding ecology of eelgrass fish communities. Trans. Am. Fish. Soc. 105(4):514-519. (Ref. 30599)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Benthic invertebrates.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Harmelin-Vivien, M. L. and J. C. Qu?, 1990; Claro, R., 1994; Maigret, J. and B. Ly, 1986; Breine, J. J., D. Nguenga, G. G. Teugels and F. Ollevier, 1996; Robins, C. R. and G. C. Ray, 1986; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Benthic invertebrates
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eggs probably pelagic.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Harmelin-Vivien, M. L. and J. C. Qu?, 1990; Claro, R., 1994; Maigret, J. and B. Ly, 1986; Breine, J. J., D. Nguenga, G. G. Teugels and F. Ollevier, 1996; Robins, C. R. and G. C. Ray, 1986; Whitehead, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stephanolepis hispidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATATAATCTTTGGTGCCTGAGCAGGAATAGTGGGGACTGCTTTAAGCCTACTAATTCGGGCAGAGCTGAGCCAGCCCGGCGCCCTTCTTGGGGACGACCAAATGTACAATGTAGTCGTCACAGCTCATGCCTTTGTAATAATTTTCTTTATAGTTATGCCCATCATAATTGGAGGCTTTGGAAACTGACTTATTCCTCTTATGATCGGAGCTCCTGATATAGCATTCCCGCGTATGAATAACATGAGCTTTTGACTTCTGCCCCCTTCCTTCCTGCTTCTCCTTGCATCATCTGGGGTCGAGGCAGGAGCTGGTACCGGTTGGACTGTTTACCCCCCTCTTGCAGGCAACCTTGCCCACGCGGGAGCTTCTGTAGACTTAACTATCTTTTCTCTCCACCTGGCTGGTATCTCTTCAATTCTCGGAGCTATTAATTTTATCACTACAATTATGAATATAAAACCCCCTGCAATGACACAATATCAGATGCCCCTATTTGTATGAGCTGTTCTCGTTACTGCTGTCCTCCTACTTCTTTCATTACCTGTCCTGGCCGCAGGAATTACTATGCTCTTAACAGATCGAAATTTAAACACTACCTTTTTCGACCCTGCAGGAGGTGGAGACCCTATCTTATACCAACACCTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stephanolepis hispidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Stephanolepis hispidus

Stephanolepis hispidus, the planehead filefish, is a species of bony fish, a ray-finned fish in the family Monacanthidae.

Description[edit]

The planehead filefish grows to a maximum length of 27 centimetres (11 in) but is more typically about 17 centimetres (6.7 in) long. The colour is cryptic, being a more or less mottled pale brown, olive or green on a light coloured background, sometimes with darker brown splotches and streaks. The fish is laterally compressed and deep bodied. The snout is elongated with a terminal mouth. The large yellow eye is set high on the head and above it is a prominent retractable spine. This is the anterior of the 2 spines associated with the long dorsal fin, which also has 29 to 35 soft rays. The anal fin has no spines and between 30 and 35 soft rays. The pectoral fins are small and the tail fin is large and fan-shaped, often with two darker coloured bands.[2][3][4]

Distribution and habitat[edit]

The planehead filefish is found in the Atlantic Ocean at depths of up to 300 metres (980 ft). Its range extends from Nova Scotia to Uruguay in the west and from the Canary Islands to Angola in the east. It is found near the seabed on reefs and over sandy and muddy sea floors. It is often found among Sargassum seaweed.[2]

Biology[edit]

In the Canary Islands the growth and ageing of the planehead filefish have been studied. Spawning takes place in the summer and the age of the fish is established by using the fast and slow growth rings found in the anterior dorsal fin spine.[5] The species has a lifespan of about three years and reaches half its final length by the end of its first year.[5]

Uses[edit]

The planehead filefish can be used for human consumption. In the Canary Islands it is caught in fish traps and at one time was considered to be a by-catch, incidental to the capture of other, more desirable fish. However, since the 1980s, it has become a target species in its own right and by 2000, there were concerns about overfishing.[5]

References[edit]

  1. ^ a b Bailly, Nicolas (2010). "Stephanolepis hispidus (Linnaeus, 1766)". World Register of Marine Species. Retrieved 2012-01-04. 
  2. ^ a b Stephanolepis hispidus (Linnaeus, 1766) FishBase. Retrieved 2012-01-04.
  3. ^ Stephanolepis hispidus, Marine Species Identification Portal. Retrieved 2012-01-04.
  4. ^ Frederick H. Berry and Louis E. Vogele (1959). "Filefishes (Monacanthidae) of the western North Atlantic". Fishery Bulletin 61: 61–109. 
  5. ^ a b c Berry, Frederick H.; Voegle, Louis E. (2004). "Age and growth of Stephanolepis hispidus (Linnaeus, 1766) (Pisces: Monacanthidae), in the Canary Islands area". Fisheries Research 66 (2-3): 381–386. doi:10.1016/j.fishres.2003.07.002. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!