Overview

Comprehensive Description

Biology

Occurs in shallow water down to 50 m depth, over sandy and rocky bottoms, but more commonly in grass beds (Ref. 3790). Often seen moving head down among seagrass blades (Ref. 9710). The young are often associated with floating Sargassum (Ref. 3720). Feeds on plants and algae, and also on small crustaceans (Ref. 3720). Rarely consumed (Ref. 3790).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Newfoundland, Bermuda and northern Gulf of Mexico to Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Newfoundland (Canada), Bermuda, and northern Gulf of Mexico to Argentina, including the Caribbean (Ref. 3790). Eastern Atlantic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic, in tropical and temperate waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Newfoundland (Canada), Bermuda, and northern Gulf of Mexico to Argentina, including the Caribbean. Eastern Atlantic.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Gibbs, R. H., Jr., 1978; Lieske, E. and R. Myers, 1994; Tyler, J. C., 1978; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 29 - 37; Analspines: 0; Analsoft rays: 28 - 36
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 20 cm TL (male/unsexed).
  • Bigelow, H. B. and Schroeder, W. C., 1953; Gibbs, R. H., Jr., 1978; Lieske, E. and R. Myers, 1994; Tyler, J. C., 1978; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Snout prominently projecting but not very elongate; first dorsal spine originating above posterior part of eye; adult males with two pairs of enlarged recurved spines on each side of caudal peduncle; spines of females only slightly larger than other scale spinules of caudal peduncle (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found to 50m depths, commonly in grass beds, but also over sandy and rocky bottoms.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range ? - 50 m (Ref. 3790)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 162 specimens in 1 taxon.
Water temperature and chemistry ranges based on 120 samples.

Environmental ranges
  Depth range (m): 0 - 2683
  Temperature range (°C): 4.226 - 27.438
  Nitrate (umol/L): 0.174 - 26.423
  Salinity (PPS): 34.937 - 37.286
  Oxygen (ml/l): 3.728 - 5.209
  Phosphate (umol/l): 0.075 - 1.419
  Silicate (umol/l): 0.756 - 25.869

Graphical representation

Depth range (m): 0 - 2683

Temperature range (°C): 4.226 - 27.438

Nitrate (umol/L): 0.174 - 26.423

Salinity (PPS): 34.937 - 37.286

Oxygen (ml/l): 3.728 - 5.209

Phosphate (umol/l): 0.075 - 1.419

Silicate (umol/l): 0.756 - 25.869
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 50m.
Recorded at 50 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reef-associated; marine; depth to 50 m. Found associated with sandy and rocky bottoms, but more commonly in grass beds. Young are often associated with floating Sargassum.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Gibbs, R. H., Jr., 1978; Lieske, E. and R. Myers, 1994; Tyler, J. C., 1978; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on plants, planktonic and benthic invertebrates (Ref. 33).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mostly plants and algae, also on small crustaceans
  • Bigelow, H. B. and Schroeder, W. C., 1953; Gibbs, R. H., Jr., 1978; Lieske, E. and R. Myers, 1994; Tyler, J. C., 1978; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on plants, algae and small crustaceans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

no information.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Gibbs, R. H., Jr., 1978; Lieske, E. and R. Myers, 1994; Tyler, J. C., 1978; Robins, C. R. and G. C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Monacanthus ciliatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Monacanthus ciliatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTCGGTGCCTGAGCCGGAATGGTAGGCACTGCCTTAAGCCTACTAATTCGAGCAGAACTAAGCCAACCTGGAGCACTCCTGGGAGACGATCAAATCTATAATGTGATCGTTACAGCCCACGCTTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATCGGAGGGTTCGGCAACTGACTGATCCCCCTAATGATTGGAGCCCCCGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGATTACTCCCCCCTTCATTCCTGCTCCTCCTTGCTTCTTCAGGAGTTGAAGCCGGGGCTGGGACCGGATGAACTGTCTACCCGCCCCTTGCAGGCAACCTCGCCCATGCAGGAGCGTCCGTAGATCTTACTATTTTCTCGCTTCATTTGGCAGGAATTTCATCAATTCTTGGTGCAATCAACTTCATCACAACAATTATTAACATGAAGCCCCCTGCAATTTCTCAATACCAAACCCCTCTCTTCGTATGAGCCGTTCTAATCACTGCCGTACTGCTTCTTCTCTCACTACCAGTCCTTGCCGCAGGAATTACTATGCTATTAACAGACCGAAACCTAAACACCACCTTCTTTGACCCCGCTGGAGGAGGAGACCCCATTCTGTACCAGCACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!