Misgurnus anguillicaudatus — Details

Oriental Weatherloach (german: Ostasiatischer Schlammpeitzger) learn more about names for this taxon

Overview

Comprehensive Description

Biology

Found in rivers, lakes and ponds. Also in swamps and rice fields (Ref. 27732, 44894). Adults prefer still or gently flowing water (Ref. 44894), also the muddy bottoms, where they hide in the muck and leaf litter with only their heads sticking out; also found in muddy bottoms of streams and ponds; in Hawaii, can also be found under mats of honohono (Commelina diffusa and California grass (Brachiara nuatica). Feed on worms, small crustaceans, insects, insect larvae, and other small aquatic organisms (Ref. 44091). Benthic (Ref. 58302). Can tolerate temperatures between 2 and 30°C, and can breathe air to supplement respiratory requirements in oxygen-depleted waters. Commonly used by anglers as live bait, so escapes may also have contributed to their spread (Ref. 44894).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to eastern Asia. Introduced (due to escapes from aquarium supply companies in 1930s) and established in headwaters of Shiawassee River, Oakland County, Michigan; Harton Davis Canal, Ada County, Idaho; and in several flood control canals in Huntington Beach and Westminster, Orange County, California; common (Lee et al. 1980, Courtenay et al. 1987, Page and Burr 1991). Has been collected in Florida and Oregon, where not known to be established (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Asia: Native to Siberia (Tugur and Amur drainages), Sakhalin, Korea, Japan, China south to northern Vietnam. Europe: Introduced in several localities in Rhine (Germany) and Ticino (Italy, north of Milano) drainages, Aral Sea basin, North America, Australia and Hawaii.This species proved successful in the aquarium fish trade and has also been introduced to other countries (Ref. 1739). At least one country reports adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 22 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 248 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

28.0 cm SL (male/unsexed; (Ref. 59043))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dorsal view shows the male with larger pectoral fins and the female with fuller abdomen (Ref. 44091). Body is mottled with darker greenish-gray to dark brown markings, against a yellow-brown to brown color; conspicuous adipose crests along the ventral and dorsal mid-lines of the caudal peduncle; 10 barbels; suborbital spine hidden in the skin (Ref. 27732).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Yangtze River Demersal Habitat

This taxon is one of a number of demersal species in the Yangtze River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton.

The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Prior to construction of the dam, the Three Gorges area was a site of exceptional natural beauty; after dam construction the gorge areas were filled with approximately 100 meters in depth of Yangtze water, and considerable amounts of the watershed were graded.

The lower Yangtze basin consists of anabranching river structures and Pleistocene coastal terraces. Prior to development of the Three Gorges Dam, the Yangtze Delta was replenished with a copious sediment load reaching the river mouth; however, the dam has now severely limited the natural flow and deposition of sediment to the delta region. Consequently, the integrity of the delta is been compromised, with scouring exceeding deposition, and the very stability of the delta is endangered.

Lower and middle basins of the Yangtze carry heavy pollutant loads. In the lower Yangtze basin nitrate levels are high, measuring at about 1000 tons per day at Datong; these levels accrue from high applications of chemical fertilizer applied and also considerable loadings of untreated sewage due to the large human population of the basin, with correspondingly little infrastructure for sewage treatment.

Heavy metal concentrations are also high in the lower Yangtze, with measurements of dissolved lead at 0.078 microgram/liter; cadmium (0.024 microgram/liter), chromium (0.57 microgram/liter), copper (1.9 microgram/liter), and nickel (0.50 microgram/liter). Levels of dissolved arsenic have been measured at 3.3 microgram/liter) and zinc at 1.5 microgram/liter), both notably higher by factors of 5.5 and 2.5 respectively than other typical large world rivers. In Yangtze River suspended sediment, arsenic comprises 31 microgram/gram, lead comprises 83 microgram/gram, and nickel comprises 52 micrograms/gram of sediment content

There are several large native demersal fish found in the Yangtze River, chiefly the 250 centimeter (cm) long endangered Yangtze sturgeon (Acipenser dabryanus), the 120 cm Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus), the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis. Furthermore, there are a few exceptionally large native benthopelagic fishes found in the Yangtze, namely, the 105 cm Silver carp (Hypophthalmichthys molitrix), the 200 cm Wuchang bream (Megalobrama amblycephala), the 200 cm yellowcheek (Elopichthys bambusa), the 145 cm common carp (Cyprinus carpio carpio), the 122 cm Mongolian redfin (Chanodichthys mongolicus), the 102 cm predatory carp (Chanodichthys erythropterus) and the 100 cm snakehead (Channa argus argus).. The demersal fish Silurus meridionalis also is found as a Yangtze River endemic species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat Type: Freshwater

Comments: Quiet or slow-flowing waters where it burrows in muddy substrate. Tolerates poorly oxygenated water (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater; depth range 5 - ? m (Ref. 27732)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in rivers, lakes and ponds. Also in swamps and ricefields (Ref. 27732). Prefers muddy bottoms, where they hide in the muck and leaf litter with only their heads sticking out; prefers muddy bottoms of streams and ponds; in Hawaii, can also be found under mats of honohono (Commelina diffusa and California grass (Brachiara nuatica); feeds on worms, small crustaceans, insects, insect larvae, and other small aquatic organisms (Ref. 44091).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Omnivorous.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Yellow Grub. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Viral Diseases (general). Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Turbidity of the Skin (Freshwater fish). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hidden Viral Infection. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Intestinal accessory respiratory organ enables this species to survive in deoxygenated water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male wraps his body around the female and stimulates her to release a cloud of eggs, which he simultaneously fertilizes (Ref. 44091).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Eggs adhesive.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Alkaline surfaces volatilize ammonia: loach
 

The alkaline body surfaces of the loach protect from ammonia toxicity by volatilizing ammonia during aerial exposure.

     
  "The loach Misgurnus anguillicaudatus is unusual in that it tolerates very high ammonia levels in its tissues, but in turn these high levels, together with alkaline body surfaces, permit a significant ammonia excretion by volatilization during aerial exposure." (Tsui et al. 2002:659)
  Learn more about this functional adaptation.
  • Tsui, T. K. N.; Randall, D. J.; Chew, S. F.; Jin, Y.; Wilson, J. M.; Ip, Y. K. 2002. Accumulation of ammonia in the body and NH3 volatilization from alkaline regions of the body surface during ammonia loading and exposure to air in the weather loach Misgurnus anguillicaudatus. Journal of Experimental Biology. 205(5): 651-659.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Misgurnus anguillicaudatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC7698-09|DQ026434|Misgurnus anguillicaudatus| ACACGCTGATTCTTCTCTAATAACCACAAAGATATTGGCACCCTCTACCTTGTATTTGGAGCCTGAGCCGGAATGGTCGGAACGGCTCTC---AGCCTTTTGATTCGTGCTGAGCTCAGCCAACCTGGATCTCTCCTGGGGGAT---GACCAAATTTATAATGTTATTGTTACCGCACATGCCTTTGTCATGATTTTCTTTATAGTAATGCCAATTCTCATCGGTGGCTTTGGAAATTGACTAATTCCATTAATG---ATTGGGGCCCCAGATATAGCGTTTCCACGAATAAACAACATAAGCTTTTGACTCCTGCCACCCTCATTTCTACTATTACTAGCCTCCTCTGGTGTTGAAGCTGGGGCTGGAACAGGATGAACAGTTTACCCGCCGCTGGCAGGTAATCTTGCCCATGCAGGTGCATCCGTTGACCTT---ACCATCTTTTCTCTTCACCTGGCAGGTGTATCTTCAATTCTGGGAGCAATTAATTTTATTACCACGACAATTAATATGAAACCCCCAGCCATTTCACAATATCAAACACCCTTATTTGTCTGAGCAGTCCTTGTAACCGCCGTTCTTCTCCTTTTGTCCCTGCCTGTCTTAGCTGCT---GGGATTACTATGCTTTTAACAGACCGAAACCTAAATACAACATTCTTTGACCCGGCAGGAGGAGGAGACCCAATCCTATACCAGCACTTATTCTGATTCTTTGGCCACCCAGAAGTATACATTTTAATTTTACCAGGATTCGGGATTATCTCACATGTTGTAGCCTACTACGCTGGTAAAAAA---GAACCTTTCGGCTACATGGGAATAGTTTGAGCTATGATGGCCATTGGCCTCCTAGGCTTCATTGTCTGAGCCCACCATATGTTTACGGTCGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Misgurnus anguillicaudatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; aquarium: commercial; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Misgurnus anguillicaudatus

The Dojo Loach (Misgurnus anguillicaudatus), is a freshwater fish in the loach family Cobitidae. They are native to Asia but are also popular as an aquarium fish. The alternate name weather loach is shared with several other Cobitinae, including the other members of the genus Misgurnus and the spotted weather loach (Cobitis taenia, commonly known as Spined Loach). This term comes from their ability to detect changes in barometric pressure and react with frantic swimming or standing on end. This is because before a storm the barometric pressure changes, and this is known to make these fish more active. The weather loach also comes in a variety of colors, such as pink, orange, and gray.

Like many other loaches, they are slender and eel-like. They can vary in color from yellow to olive green, to a common light brown or gray with lighter undersides. The mouth of the loach is surrounded by three sets of barbels. It uses them to sift through silt or pebbles to find food. It also uses them to dig under gravel and sand to conceal itself out of nervousness or defense unlike the other loaches who use the spines beneath the eyes.

They can grow up to a 12 inches (30.5 cm) long. The fish are bottom-dwelling scavengers, feeding mainly on organic material such as algae. Weather loaches are omnivorous and may also feed on tubifex worms and other small aquatic organisms. By producing a layer of mucus to keep themselves damp, they can also survive small periods of not being in the water. They are very hardy fish that can live in poor quality water.

One trait which distinguishes the dojo loach from most other tropical fish commonly seen at auarium specialty shops and pet stores is the fact that they thrive at room temperature (68-72°F, 20-23°C) and can do well even at temperatures as low as the upper 50's Fahrenheit (13-15° Celsius). The usual tropical temperature will result in a significantly reduced lifespan (from an average 10 years to four or less). Purchasers often presume when buying tropical freshwater fish that all species will thrive in the (typical for home freshwater aquarium installations) 76-82°F / 24-28°C range; this presumption is incorrect in the case of the dojo loach.

Sometimes the dojo loach (especially the golden variety) is mistaken for the kuhli loach. The kuhli, however, likes warm tropical temperatures, will tolerate more acidic conditions, and matures at a much smaller four inches (10cm). Although these two species have numerous differentiating traits, individual kuhli and dojo loaches may resemble ine other while young, and at the usual age and size of what most fish stores market.

Contents

In the aquarium

Side view of a pink loach

Weather loaches are active, peaceful, and hardy fish that are sometimes used as starter fish in an aquarium. They can be "friendly" towards humans, allowing physical contact and hand feeding. They have, however, been known to attack very small fish in smaller aquariums. They get along better with goldfish.

There are other varieties bred from captivity like the gold strain and the peppered strain (not to be confused with the pepper loach).


The loaches will be more active given more space and greater numbers. Solitary weather loaches tend to spend much of their time hiding. They will spend a lot of time hiding or staying still, but should be given a place to stay which will have cover and shade. Tank decorations that they can swim through and driftwood both work great for this. Due to their jumping ability the average cover should be enhanced with tape or other barriers. However, if you happen to find your loach black and dry on the floor one morning, try placing it back in the aquarium. Usually it will revive and swim away and make a full recovery. In some cases, it has been reported that they can live up to three days out of a tank. Also, they may even travel up tubes and take up residence in filters, so check there if your dojo doesn't show up for roll call one day. Weather loaches enjoy digging and burrowing themselves in the substrate of their tank, so make sure that your substrate is fine enough for them to dig in. If you keep live plants in your tank, they will be uprooted by the loaches, so it is a good idea to weight your plants. The weather loach is also peculiar in that it will sometimes bury itself in the substrate during times of stress. This often surprises new owners, as the fish will "disappear" shortly after introduction to the tank only to "reappear" later.

Because of their appetite for snails, these loaches can help alleviate snail infestations in tropical fish tanks, though many have reported that while weather loaches do eat snails, they do not eat them at a fast enough rate to deal with an infestation.

The fish prefer a pH of 6.5-8.0 but will tolerate far more acidic conditions even for extended amounts of time with little negative reaction. This makes the Weather Loach a great choice for first-time aquariums and for those who want a fish tank but do not want the intense, daily attention other fish require. This fish should be kept in groups of at least 3, as they like to be in physical contact with each other and feel each other with their barbels when they rest.

As food

Loaches cooked in a small pot at Komagata Dozeu, Tokyo, Japan

The weather loach is a common food fish in East Asia, raised on a large scale in fish farming.

See also

References

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!