Overview

Comprehensive Description

Description

  Common names: puffer (English), tamboril (Espanol), botete (Espanol)
 
Sphoeroides annulatus (Jenyns, 1842)



Bullseye puffer



Body relatively elongate, the depth 25-33% of SL; head large, blunt; snout length greater than distance between eye and gill opening; wide and convex between eyes; nasal organ a short papilla with 2 small holes at end; eyes high on sides of head; jaws are a strong beak composed of 4 fused heavy powerful teeth with a central suture on each jaw; a slit-like gill opening in front of the pectoral fin base; a single short- based dorsal fin at rear of body; a similar-shaped anal fin with origin under or behind last few dorsal rays; dorsal rays 7-9, anal rays 6-9; no pelvic fins; no spines in the fins; tail fin bluntly convex, with 10 main rays; tough scaleless skin,  small spines on head and body, none on tail base or before nostrils.



Blackish to olive brown on upper half, white below  narrow white to yellow lines, bars, and oblique bands on head and back, with a double concentric oval on top of back, and 3 narrow pale cross-bars between the ovals and eyes; head, sides and upper back, with numerous small dark spots; iris yellow.


Size: to 48 cm.

Common on rocky reefs and adjacent sand patches, often seen in midwater high off the bottom or at the surface.

Depth: 1-105 m.

Southern California to the Gulf of California to Peru, including Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found on soft bottom (Ref. 9349). Juveniles inhabit estuaries (Ref. 9349). Makes a loud grating noise (Ref. 3157).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This eastern Pacific species is found from southern California to Pisco, Peru, and the Galapagos islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: California, USA to Pisco, Peru and the Galapagos Islands.
  • Bussing, W.A. 1995 Tetraodontidae. Tamboriles, tamborines, botetes, peces globo, corrotuchos. p. 1629-1637. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9349)   http://www.fishbase.org/references/FBRefSummary.php?id=9349&speccode=14159 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 105 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 8; Analspines: 0; Analsoft rays: 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 48.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 440 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

44.0 cm TL (male/unsexed; (Ref. 9349))
  • Bussing, W.A. 1995 Tetraodontidae. Tamboriles, tamborines, botetes, peces globo, corrotuchos. p. 1629-1637. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9349)   http://www.fishbase.org/references/FBRefSummary.php?id=9349&speccode=14159 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Remarkable for its highly tortuous lateral line; its nostrils also rather peculiar (Ref. 3157).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is common on rocky reefs (including tide pools) and adjacent sand patches and is often seen in mid-water high off the bottom or at the surface. It is found to 105m. Juveniles inhabit the high and middle salinity portions of estuaries (Bussing 1995; Cooke 1992) including mangrove habitats (Cooke 1992; Aguirre et al. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 0 - 11 m (Ref. 5227)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 184 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0.21 - 410
  Temperature range (°C): 9.271 - 22.948
  Nitrate (umol/L): 0.144 - 29.871
  Salinity (PPS): 34.073 - 35.311
  Oxygen (ml/l): 0.276 - 5.132
  Phosphate (umol/l): 0.352 - 2.834
  Silicate (umol/l): 2.344 - 52.132

Graphical representation

Depth range (m): 0.21 - 410

Temperature range (°C): 9.271 - 22.948

Nitrate (umol/L): 0.144 - 29.871

Salinity (PPS): 34.073 - 35.311

Oxygen (ml/l): 0.276 - 5.132

Phosphate (umol/l): 0.352 - 2.834

Silicate (umol/l): 2.344 - 52.132
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 11m.
Recorded at 11 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish, Freshwater

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel, Estuary, Mangrove, Freshwater

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on soft bottom (Ref. 9349). Juveniles inhabit estuaries (Ref. 9349). Makes a loud grating noise (Ref. 3157).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Benthic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphoeroides annulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTGGTATTTGGTGCCTGAGCCGGAATAGTGGGGACGGCCTTAAGCCTCCTCATTCGGGCAGAACTAAGCCAACCCGGCGCACTCCTAGGTGACGACCAGATCTATAATGTAATCGTCACGGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGCGGTTTCGGAAACTGACTAGTCCCACTTATGATCGGAGCTCCCGACATGGCATTCCCCCGTATAAACAACATAAGCTTCTGACTCCTGCCCCCCTCATTCCTTCTCCTGCTCGCCTCCTCTGGAGTAGAAGCTGGAGCTGGAACAGGATGAACTGTATATCCCCCTCTGGCCGGAAACCTGGCACACGCAGGGGCCTCGGTAGACCTAACCATCTTCTCCCTGCATCTTGCAGGGGTCTCCTCAATTCTAGGGGCCATTAATTTCATCACCACAATTATTAACATAAAACCCCCTGCCATCTCACAATATCAGACGCCCCTGTTTGTATGGGCTGTCCTAATCACTGCCGTCCTTCTTCTGCTCTCCCTCCCCGTTCTTGCGGCAGGCATCACAATGCTTCTCACAGACCGAAACCTTAATACCACATTCTTCGACCCAGCAGGCGGAGGAGACCCCATTCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sphoeroides annulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Nielsen, J.G., Munroe, T. & Tyler, J.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is widespread and common in the tropical eastern Pacific. It has no major threats and can be found in some Marine Protected Areas. Therefore, this species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a common species within its range. There is no population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species specific conservation measures. However, this species may be found in Marine Protected Areas within its distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sphoeroides annulatus

Bullseye puffer (Sphoeroides annulatus) is a species in the family Tetraodontidae, or pufferfishes. Found in the eastern Pacific Ocean from California, USA to Pisco, Peru and the Galápagos Islands.[1]

References

  1. ^ Sphoeroides annulatus, Fishbase.org
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!