Overview

Comprehensive Description

Biology

Found inshore on the continental shelf (Ref. 6871). Frequents rocky and coral reef areas. Biology almost unknown. Ovoviviparous (Ref. 6871). May possibly grow to 200 or 300 cm TL.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Occurs from the Abrolhos Islands in Western Australia to Adelaide in South Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Australia: South Australia and Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Indian Ocean: Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 920 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

92.0 cm TL (male/unsexed; (Ref. 247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs in rocky reef and weedy areas on the continental shelf. Little is known of its ecology, but like other wobbegong sharks it is unlikely to move large distances, spending most of its time lying on the bottom. It is an ambush predator, and Chidlow (2003) reported that the stomach contents of 11 specimens all contained teleost prey.

A small species growing to less than a meter in length (92 cm), with males maturing about 65 cm. Ovoviviparous development, with young born at about 22 cm. Chidlow (2003) reported only one pregnant female which contained 12 developing embryos with a sex ratio strongly biased towards males.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sutorectus tentaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATGGTTATACCAGTAATAATCGGTGGATTTGGAAATTGATTAGTACCATTAATAATTGGTGCACCCGACATAGCATTCCCTCGGATAAATAACATAAGCTTTTGACTCCTTCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTCTACCCACCATTAGCGGGCAATTTAGCCCACGCCGGAGCATCAGTTGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAATATAAAACCACCAGCTATTTCTCAATATCAAACACCTCTATTTGTTTGATCAATTCTTGTAACCACAATCCTCCTCCTACTAGCATTACCAGTTTTAGCAGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sutorectus tentaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Simpfendorfer, C.A. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group (Shark Red List Authority)

Contributor/s

Justification
Sutorectus tentaculatus is a common southwestern Australian endemic species occurring in inshore waters around rocky reefs and in weedy areas. It is caught occasionally by demersal gillnet fishers throughout its range in Western Australia, but is normally discarded alive. It is also taken by recreational anglers fishing around reefs for teleost species. At present there appears to have been no significant impact on the population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information is available on subpopulations, but it appears to be most common in southwestern Western Australia.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Occasionally caught in demersal gillnets throughout its range in Western Australia. However, its small size makes it of limited commercial value and it is normally discarded alive. It is not been recorded in the catches from demersal gillnets or trawls in South Australia (T. Walker, MAFRI, pers. comm). Recreational anglers in south-western Western Australia occasionally catch this species when fishing for teleosts around rocky reefs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The gillnet fisheries in which it is caught are managed, but there are no conservation measures specifically aimed at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cobbler wobbegong

The cobbler wobbegong, Sutorectus tentaculatus, is a carpet shark in the family Orectolobidae, the only member of the genus Sutorectus. It is found in the subtropical eastern Indian Ocean around Western Australia between latitudes 26° S and 35° S. It is frequently found in rocky and coral reef areas. Cobbler wobbegong reaches a length of 92 cm.

Its reproduction is ovoviviparous.

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!