Overview

Comprehensive Description

Biology

Found inshore on the continental shelf (Ref. 6871). Frequents rocky and coral reef areas. Biology almost unknown. Ovoviviparous (Ref. 6871). May possibly grow to 200 or 300 cm TL.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Cobbler Wobbegong is an Australian endemic, known only from the inner continental shelf off southwest and southern Australia, from Houtman Abrolhos in Western Australia to Adelaide in South Australia (Last and Stevens 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia: South Australia and Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean: Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 920 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

92.0 cm TL (male/unsexed; (Ref. 247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Cobbler Wobbegongoccurs on rocky reef and weedy areas on the continental shelf to at least 35 m depth (Last and Stevens 2009). Little is known of its ecology, but like other wobbegongs it is unlikely to move large distances, spending most of its time lying on the seabed.

A small species growing to at least 92 cm total length (TL), with males maturing at about 65 cm TL, and size at birth approximately 22 cm TL. Since the reproductive mode of all other wobbegongs (family Orectolobidae)is lecithotrophic viviparity, it is likely that the Cobbler Wobbegong has a similar reproductive mode (Huveneers et al. 2007, Huveneers et al. 2011).Chidlow (2003) reported only one pregnant female which contained 12 developing embryos with a sex ratio strongly biased towards males.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sutorectus tentaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATGGTTATACCAGTAATAATCGGTGGATTTGGAAATTGATTAGTACCATTAATAATTGGTGCACCCGACATAGCATTCCCTCGGATAAATAACATAAGCTTTTGACTCCTTCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTCTACCCACCATTAGCGGGCAATTTAGCCCACGCCGGAGCATCAGTTGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAATATAAAACCACCAGCTATTTCTCAATATCAAACACCTCTATTTGTTTGATCAATTCTTGTAACCACAATCCTCCTCCTACTAGCATTACCAGTTTTAGCAGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sutorectus tentaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Huveneers, C. & Simpfendorfer, C.

Reviewer/s
Walls, R.H.L. & Kyne, P.M.

Contributor/s

Justification
The Cobbler Wobbegong (Sutorectus tentaculatus) is a small (to at least 92 cm total length) Australian endemic. This species is known only from shallow waters on the continental shelf off southwest and southern Australia, between the Houtman Abrolhos (Western Australia) and Adelaide (South Australia), at depths to at least 35 m.Although little is known about the biology of the species,itis a minor bycatch component of the Western Australian temperate demersal gillnet and demersal longlinefisheries, which only catch ~40 tonnes of wobbegongs per year, and minimal catches in other parts of its distribution. In addition,the Cobbler Wobbegongis unlikely to be retained due to its small size and post-release survival of wobbegongs is expected to be high. Further research is required on the species' biology, occurrence and capture in fisheries, but there is no evidence to infer or suspect population decline, so the species is listed as Least Concern.

History
  • 2003
    Least Concern (LC)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Nothing is currently known of the population size or trend of this species, but it appears to be most common in southwest Western Australia.No information is available on the existence of subpopulations.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

TheCobbler Wobbegongis a small component of the bycatch of the Western Australian temperate demersal gillnet and demersal longlinefisheries. The species, along with other wobbegong species occurring within the region, isprimarily caught by demersal gillnets off the southern and lower west coasts of Western Australia. A fisheries-dependent survey of southwest Western Australia fisheries reported thattheCobbler Wobbegongconstituted 0.9% of total elsamobranch catches from gillnets (Joneset al.2010). Wobbegongs were historically also caught by a few vessels using demersal longlines in the same fishery until the use of that gear was restricted in 2006. The Western Australian temperate demersal gillnet and demersal longlinefisheries mean annual wobbegong catch is about 40 tonnes per year(range 28-68 tonnes) between 1999 and 2014 and does not show any sign of decline(Department of Fisheries WA Fishery Status Report 1998-99 to 2013-14, for example, Braccini et al. 2014). Although wobbegong catches are generally not reported to individual species, small wobbegongs (<150 cm) are selectively discarded alive (Chidlowet al.2007, R. McAuley, pers. comm,, February 2015) due to low flesh recovery rates from smaller individual. Thus,theCobbler Wobbegongis believed to be a minor component of those aggregated catches. In addition, post-release survival of wobbegongs is thought to be high.

In South Australia,theCobbler Wobbegongis caught as bycatch in the Spencer Gulf and Gulf St Vincent prawn trawl fishery (Currie et al. 2009, SARDI unpubl. data). A survey of the Spencer Gulf prawn trawl fishery showed thattheCobbler Wobbegongwas caught in11 of the 120 sites sampled (Currie et al. 2009). The Cobbler Wobbegong is not retained and likely to have high post-release survival rates.

Small wobbegongs also occur in commercial rock lobster pots throughout temperate coastal Western Australian waters (Chidlowet al.2007). However, as all sharks and rays are now commercially protected throughout Western Australia, wobbegongs cannot generally be retained by State managed commercial fishing vessels unless they are operating in the managed shark fishery.

The retained catch of wobbegongs by recreational fishers off the west coast of Australia has been estimated at approximately 1,000 animals per year(Sumner and Williamson 1999),while the estimated annual catch during 201112 by recreational fishing from boat licence holders was 1,535 wobbegongs, with 20% or 304individuals retained (Ryanet al.2013). Assuming the species composition of recreational wobbegong catches is similar to that of the commercial gillnet fishery,theCobbler Wobbegongis also likely to be a minor component of recreational catches.

AlthoughtheCobbler Wobbegongoccurs within the western extent of theSouthern and Eastern Scalefish and Shark Fishery, the species is not or only rarely caught by this fishery (Walker and Gason 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
All sharks and rays are commercially protected under Western Australian law. This regulation essentially restricts the retention of all shark and ray products by commercial fishing vessels other than those operating in the States managed shark fishery. The likely small quantity of incidental Cobbler Wobbegongbycatch is therefore believed to be discarded alive. Although not directly tested, observational evidence suggests that wobbegongs are a hardy group. Trap caught individuals can be released in good condition and post-release survival is presumed likely.

Relative to the area known to be occupied by theCobbler Wobbegong, shark fishing effort (mainly demersal gillnet) is sparsely distributed and managed within specific regional limits via time-gear input controls.For example, the Metropolitan Fishing Zone, between Lancelin and south of Mandurah, was closed to commercial line and gillnet fishing in2007as part of a fishing reform package to ensure sustainability of fish for the future.The managed shark fishery's catches and fishing effort are also routinely monitored through analyses of statutory daily/trip logbook data and the fishery's target stocks are subject to regular stock assessments.

The use of commercial shark fishing gear (large mesh gillnets and demersal longlines) is prohibited north of 2630S latitude to 120'E longitude off the north coast, which may include the northern extent of the species range.The use of metal snoods (gangions) is commercially prohibited throughout Western Australian waters (except for a small amount of demersal longline effort in the managed shark fishery and pelagic mackerel troll lines).Recreational fishers are subject to a daily bag limit of two sharks per person.

Site attached species such as wobbegongs may also benefit from habitat protection and suitably designed and implemented no-take zones, where all forms of harvesting or fishing are excluded (Huveneerset al. 2006, Lee 2014).This species is potentially protected in the following Australian marine protected areas, marine parks and nature reserves:

Shark Bay Marine Park, WA
Jurien Bay Marine Park, WA
Hamelin Pool Marine Nature Reserve, WA
Shoalwater Islands Marine Park, WA
Marmion Marine Park , WA
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cobbler wobbegong

The cobbler wobbegong, Sutorectus tentaculatus, is a carpet shark in the family Orectolobidae, the only member of the genus Sutorectus. It is found in the subtropical eastern Indian Ocean around Western Australia between latitudes 26° S and 35° S. It is frequently found in rocky and coral reef areas. Cobbler wobbegong reaches a length of 92 cm. It has unbranched dermal lobes on the head, rows of warty tubercles along the back and black spots on the body and fins.[1]

Its reproduction is ovoviviparous.

See also[edit]

References[edit]

  1. ^ Dianne J. Bray, 2011, Cobbler Wobbegong, Sutorectus tentaculatus, in Fishes of Australia, accessed 07 Oct 2014, http://www.fishesofaustralia.net.au/home/species/1979
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!