Overview

Comprehensive Description

Biology

Inhabits subtidal reef flats and outer lagoon and seaward reefs (Ref. 1602). Usually in areas with mixed sand, rubble, and coral (Ref. 9710). Feeds mainly on gastropods, other hard-shelled prey (Ref. 9823), and foraminiferans (Ref. 37816). Rarely marketed. Minimum depth reported from Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Cocos-Keeling Islands in the eastern Indian Ocean to western Pacific and islands of Oceania.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found in the Indo-Pacific ranging north from southern Japan and south to Sydney in Australia and east from Cocos-Keeling Atoll, East to the Pitcairn Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mozambique
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 11; Vertebrae: 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Color in life of young and females whitish to greenish with irregular black spots; males orange-red with greenish yellow spots (edged in blue and black, per scale); head spotted and banded. Anterior lateral line scales with 2-4 pores. Pelvic fins short, not reaching anus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 30 m (Ref. 1602), usually 0 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits shallow patch reefs, lagoons, and bays with sand and rubble substrate in depths of one to at least 30 m. It feeds on micro-zoobenthos.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 1 - 39.5
  Temperature range (°C): 25.335 - 29.058
  Nitrate (umol/L): 0.027 - 0.622
  Salinity (PPS): 33.950 - 35.376
  Oxygen (ml/l): 4.444 - 4.757
  Phosphate (umol/l): 0.055 - 0.284
  Silicate (umol/l): 0.803 - 4.892

Graphical representation

Depth range (m): 1 - 39.5

Temperature range (°C): 25.335 - 29.058

Nitrate (umol/L): 0.027 - 0.622

Salinity (PPS): 33.950 - 35.376

Oxygen (ml/l): 4.444 - 4.757

Phosphate (umol/l): 0.055 - 0.284

Silicate (umol/l): 0.803 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Feeds on detritus, benthic and planktonic invertebrates (Ref. 6110).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macropharyngodon meleagris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGAGCCTGAGCCGGGATAGTGGGCACGGCCCTAAGCTTGCTCATCCGAGCCGAACTTAGCCAGCCCGGTGCTCTCCTCGGAGATGACCAGATCTACAACGTTATCGTAACAGCCCATGCTTTCGTAATGATCTTCTTTATAGTAATACCCATTATGATTGGCGGGTTTGGGAACTGACTAATTCCATTAATGATCGGGGCCCCTGACATGGCCTTTCCCCGAATAAACAACATGAGCTTTTGACTTCTGCCCCCCTCCTTCCTCCTCCTCCTGGCCTCATCAGGCGTAGAGGCCGGGGCAGGAACTGGCTGAACAGTATACCCCCCTTTAGCAGGAAACCTCGCCCATGCAGGAGCATCCGTGGACCTAACTATCTTTTCGCTGCACTTAGCTGGTATCTCTTCTATTTTAGGCGCAATTAACTTTATTACAACCATTGTTAACATAAAACCCCCAGCCATTTCACAGTATCAGACACCTCTATTCGTCTGAGCCGTTTTAATTACAGCAGTCCTGCTACTCCTCTCCCTCCCAGTCCTAGCTGCCGGCATCACCATGCTTCTAACTGACCGAAACCTAAATACTACGTTCTTTGACCCCGCCGGAGGGGGGGACCCAATTTTATACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macropharyngodon meleagris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Craig, M. & Yeeting, B.

Reviewer/s
Rocha, L.A. & Carpenter, K.E.

Contributor/s

Justification
This species is wide ranging and common in the Indo-Pacific. There are no known major threats to the species, and it occurs within marine protected areas throughout its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no explicit information available on population trends for this species. It is generally considered as common.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species, although it is collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range (Wood 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Macropharyngodon meleagris

Macropharyngodon meleagris is a Wrasse from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 15 cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!