Macropharyngodon meleagris — Details

Guineafowl Wrasse learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Inhabits subtidal reef flats and outer lagoon and seaward reefs (Ref. 1602). Usually in areas with mixed sand, rubble, and coral (Ref. 9710). Feeds mainly on gastropods, other hard-shelled prey (Ref. 9823), and foraminiferans (Ref. 37816). Rarely marketed. Minimum depth reported from Ref. 27115.

Randall, J.E. 1978 A revision of the Indo-Pacific labrid fish genus Macropharyngodon, with descriptions of five new species. Bull. Mar. Sci. 28(4):742-770. (Ref. 2694) http://www.fishbase.org/references/FBRefSummary.php?id=2694&speccode=4984

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Indo-Pacific: Cocos-Keeling Islands in the eastern Indian Ocean to western Pacific and islands of Oceania.

Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334) http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

This species is found in the Indo-Pacific ranging north from southern Japan and south to Sydney in Australia and east from Cocos-Keeling Atoll, East to the Pitcairn Islands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Mozambique

MacNae, W. & M. Kalk (eds) (1958). A natural history of Inhaca Island, Mozambique. Witwatersrand Univ. Press, Johannesburg. I-iv, 163 pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6266
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

West Pacific and southeastern Indian Ocean.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 11; Vertebrae: 25

Randall, J.E. 1978 A revision of the Indo-Pacific labrid fish genus Macropharyngodon, with descriptions of five new species. Bull. Mar. Sci. 28(4):742-770. (Ref. 2694) http://www.fishbase.org/references/FBRefSummary.php?id=2694&speccode=4984

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 150 mm SL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

15.0 cm SL (male/unsexed; (Ref. 9823))

Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823) http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Color in life of young and females whitish to greenish with irregular black spots; males orange-red with greenish yellow spots (edged in blue and black, per scale); head spotted and banded. Anterior lateral line scales with 2-4 pores. Pelvic fins short, not reaching anus.

Randall, J.E. 1978 A revision of the Indo-Pacific labrid fish genus Macropharyngodon, with descriptions of five new species. Bull. Mar. Sci. 28(4):742-770. (Ref. 2694) http://www.fishbase.org/references/FBRefSummary.php?id=2694&speccode=4984

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

reef-associated; marine; depth range 0 - 30 m (Ref. 1602), usually 0 - 30 m (Ref. 27115)

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115) http://www.fishbase.org/references/FBRefSummary.php?id=27115&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Habitat and Ecology

Learn more about this article

Habitat and Ecology

This species inhabits shallow patch reefs, lagoons, and bays with sand and rubble substrate in depths of one to at least 30 m. It feeds on micro-zoobenthos.

Systems

Marine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 1 - 39.5
  Temperature range (°C): 25.335 - 29.058
  Nitrate (umol/L): 0.027 - 0.622
  Salinity (PPS): 33.950 - 35.376
  Oxygen (ml/l): 4.444 - 4.757
  Phosphate (umol/l): 0.055 - 0.284
  Silicate (umol/l): 0.803 - 4.892

Graphical representation

Depth range (m): 1 - 39.5

Temperature range (°C): 25.335 - 29.058

Nitrate (umol/L): 0.027 - 0.622

Salinity (PPS): 33.950 - 35.376

Oxygen (ml/l): 4.444 - 4.757

Phosphate (umol/l): 0.055 - 0.284

Silicate (umol/l): 0.803 - 4.892

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Occurs inshore (Ref. 75154). Feeds on detritus, benthic and planktonic invertebrates (Ref. 6110).

Sano, M., M. Shimizu and Y. Nose 1984 Food habits of teleostean reef fishes in Okinawa Island, southern Japan. University of Tokyo Bulletin, no. 25. v,128p. University of Tokyo Press, Tokyo, Japan. 128 p. (Ref. 6110) http://www.fishbase.org/references/FBRefSummary.php?id=6110&speccode=9950

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macropharyngodon meleagris

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 22 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGAGCCTGAGCCGGGATAGTGGGCACGGCCCTAAGCTTGCTCATCCGAGCCGAACTTAGCCAGCCCGGTGCTCTCCTCGGAGATGACCAGATCTACAACGTTATCGTAACAGCCCATGCTTTCGTAATGATCTTCTTTATAGTAATACCCATTATGATTGGCGGGTTTGGGAACTGACTAATTCCATTAATGATCGGGGCCCCTGACATGGCCTTTCCCCGAATAAACAACATGAGCTTTTGACTTCTGCCCCCCTCCTTCCTCCTCCTCCTGGCCTCATCAGGCGTAGAGGCCGGGGCAGGAACTGGCTGAACAGTATACCCCCCTTTAGCAGGAAACCTCGCCCATGCAGGAGCATCCGTGGACCTAACTATCTTTTCGCTGCACTTAGCTGGTATCTCTTCTATTTTAGGCGCAATTAACTTTATTACAACCATTGTTAACATAAAACCCCCAGCCATTTCACAGTATCAGACACCTCTATTCGTCTGAGCCGTTTTAATTACAGCAGTCCTGCTACTCCTCTCCCTCCCAGTCCTAGCTGCCGGCATCACCATGCTTCTAACTGACCGAAACCTAAATACTACGTTCTTTGACCCCGCCGGAGGGGGGGACCCAATTTTATACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Macropharyngodon meleagris

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 24
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article

Red List Category

LC

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2010

Assessor/s

Craig, M. & Yeeting, B.

Reviewer/s

Rocha, L.A. & Carpenter, K.E.

Contributor/s

Justification

This species is wide ranging and common in the Indo-Pacific. There are no known major threats to the species, and it occurs within marine protected areas throughout its range. It is therefore listed as Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trends

Population

Learn more about this article

Population

There is no explicit information available on population trends for this species. It is generally considered as common.

Population Trend

Unknown

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Least Concern (LC)

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Major Threats

There are no major threats known for this species, although it is collected for the aquarium trade.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range (Wood 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

aquarium: commercial

Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p. http://www.fishbase.org/references/FBRefSummary.php?id=9210

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Macropharyngodon meleagris

Learn more about this article

Macropharyngodon meleagris is a Wrasse from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 15 cm in length.

References

Froese, Rainer, and Daniel Pauly, eds. (2008). "Macropharyngodon meleagris" in FishBase. December 2008 version.

This Labridae article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!