Parablennius marmoreus — Details

Seaweed Blenny learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Inhabits eroded basins and limestone boulders covered by an algal mat, sea fans, etc. (Ref. 5521). Sometimes around mangrove roots, young are sometimes found in floating Sargassum (Ref. 26938). Omnivorous, but feeds mostly on algae (Ref. 13442). Oviparous (Ref. 205). Eggs are demersal and adhesive (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

The seaweed blenny, Parablennius marmoreus, is one of several species of combtooth blennies belonging to the family Blenniidae. This combtooth blenny has 35-43 comb-like incisors (Lindquist & Dillaman 1986) in addition to upper and lower canines (Ditty et al. 2005). The body of P. marmoreus is tan to rusty orange with scattered or clustered dark brown spots and a bronze area on the top of the head (Robins & Ray 1986). A wide dusky stripe extends from the eye toward the caudal fin on each side, most visible above the pectoral fin and usually fading on the rear of the body. The ventral surface of the head is whitish. The filamentous appendage above each eye, called the cirrus, is branched in this species. Fin rays and other meristic counts are as follows: dorsal spines = 6-7; dorsal soft rays = 17-18; total anal elements = 21-22; total vertebrae = 36; pelvic spines and rays = 1 and 3, respectively; pectoral fin rays = 14; and upper, primary and lower caudal fin rays = 6, 13 and 6, respectively (Ditty et al. 2005).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Bath, H. 1977. Revision der Blenniini (Pisces: Blenniidae). Senckenberg. Biol. 57: 167-234.
  • Bath, H. 1990. Taxonomie und Verbreitung von Parablennius Ribeiro 1915 an der W Kuste Afrikas und Kapverdischen Inseln mit Revalidation von P. verryckeni (Poll 1959) und Beschreibung drei neuer Arten. Senckenberg. Biol. 70: 15-69.
  • Ditty, JG. 2002. Ontogeny and intervals of development in five reef-associated species of blenny from the northern Gulf of Mexico (Teleostei: Blenniidae). PhD Dissertation. LA State Univ. USA. 168 pp.
  • Ditty, JG, Fuiman, LA & RF Shaw. 2003. Characterizing natural intervals of development in the early life of fishes: an example using blennies (Teleostei: Blenniidae). In: Browman, HI & AB Skiftesvik. The big fish bang. 405-418. Proc. 26th Annual Larv. Fish Conf. Institute of Marine Research. Bergen, Norway.
  • Ditty, JG, Shaw, RF & LA Fuiman. 2005. Larval development of five species of blenny (Teleostei: Blenniidae) from the western North Atlantic, with a synopsis of blennioid family characters. J. Fish Biol. 66: 1261-1284.
  • Labelle, M & JR Nursall. 1992. Population biology of the redlip blenny, Ophioblennius atlanticus macclurei (Sylvester) in Barbados. Bull. Mar. Sci. 50: 186-204.
  • Lindquist, DG & RM Dillaman. 1986. Trophic morphology of four western Atlantic blennies (Pisces: Blenniidae). Copeia. 1986: 207-213.
  • Longley, WH & SF Hildebrand. 1941. Systematic catalogue of the fishes of Tortugas, Florida with observations on color and local distribution. Papers Tortugas Lab. 34: 1-331.
  • Randall, JE. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Ocean. Miami. 5: 665-847.
  • Rooker, JR, Dokken, QR, Pattengill, CV & GJ Holt. 1997. Fish assemblages on artificial and natural reefs in the Flower Garden Banks National Marine Sanctuary, USA. Coral Reefs. 16: 83-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Western Atlantic: New York (USA), Bermuda, the Bahamas, Gulf of Mexico to southern Brazil.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Western Atlantic: from 43.7°N, Bermuda, the Bahamas, and northern Gulf of Mexico to northern South America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

National Distribution

Learn more about this article

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

The range of the seaweed blenny extends from New York to the northern Gulf of Mexico, Bermuda, and the Bahamas to northern South America (Robins & Ray 1986). Like other combtooth blennies, P. marmoreus can be found in rocky intertidal zones, seagrass beds, oyster reefs, or among litter such as cans and bottles strewn on the benthos. The seaweed blenny is also found on nearshore reefs, around buoys and pilings, and offshore around oil and gas platforms (Ditty et al. 2005). The India River Lagoon, the seaweed blenny occurs in several habitats. However, it seems to be most abundant around inlets where it is associated with rocky seawalls, jetties, buoys and pilings.
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Bath, H. 1977. Revision der Blenniini (Pisces: Blenniidae). Senckenberg. Biol. 57: 167-234.
  • Bath, H. 1990. Taxonomie und Verbreitung von Parablennius Ribeiro 1915 an der W Kuste Afrikas und Kapverdischen Inseln mit Revalidation von P. verryckeni (Poll 1959) und Beschreibung drei neuer Arten. Senckenberg. Biol. 70: 15-69.
  • Ditty, JG. 2002. Ontogeny and intervals of development in five reef-associated species of blenny from the northern Gulf of Mexico (Teleostei: Blenniidae). PhD Dissertation. LA State Univ. USA. 168 pp.
  • Ditty, JG, Fuiman, LA & RF Shaw. 2003. Characterizing natural intervals of development in the early life of fishes: an example using blennies (Teleostei: Blenniidae). In: Browman, HI & AB Skiftesvik. The big fish bang. 405-418. Proc. 26th Annual Larv. Fish Conf. Institute of Marine Research. Bergen, Norway.
  • Ditty, JG, Shaw, RF & LA Fuiman. 2005. Larval development of five species of blenny (Teleostei: Blenniidae) from the western North Atlantic, with a synopsis of blennioid family characters. J. Fish Biol. 66: 1261-1284.
  • Labelle, M & JR Nursall. 1992. Population biology of the redlip blenny, Ophioblennius atlanticus macclurei (Sylvester) in Barbados. Bull. Mar. Sci. 50: 186-204.
  • Lindquist, DG & RM Dillaman. 1986. Trophic morphology of four western Atlantic blennies (Pisces: Blenniidae). Copeia. 1986: 207-213.
  • Longley, WH & SF Hildebrand. 1941. Systematic catalogue of the fishes of Tortugas, Florida with observations on color and local distribution. Papers Tortugas Lab. 34: 1-331.
  • Randall, JE. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Ocean. Miami. 5: 665-847.
  • Rooker, JR, Dokken, QR, Pattengill, CV & GJ Holt. 1997. Fish assemblages on artificial and natural reefs in the Flower Garden Banks National Marine Sanctuary, USA. Coral Reefs. 16: 83-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 12; Dorsal soft rays (total): 18; Analspines: 2; Analsoft rays: 19 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 85 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

8.5 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Information concerning the maximum age and average lifespan of P. marmoreus is lacking. Growth rates vary with environmental conditions, food availability and other factors. The maximum reported size for the seaweed blenny is 8.5 cm (Robins & Ray 1986).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Bath, H. 1977. Revision der Blenniini (Pisces: Blenniidae). Senckenberg. Biol. 57: 167-234.
  • Bath, H. 1990. Taxonomie und Verbreitung von Parablennius Ribeiro 1915 an der W Kuste Afrikas und Kapverdischen Inseln mit Revalidation von P. verryckeni (Poll 1959) und Beschreibung drei neuer Arten. Senckenberg. Biol. 70: 15-69.
  • Ditty, JG. 2002. Ontogeny and intervals of development in five reef-associated species of blenny from the northern Gulf of Mexico (Teleostei: Blenniidae). PhD Dissertation. LA State Univ. USA. 168 pp.
  • Ditty, JG, Fuiman, LA & RF Shaw. 2003. Characterizing natural intervals of development in the early life of fishes: an example using blennies (Teleostei: Blenniidae). In: Browman, HI & AB Skiftesvik. The big fish bang. 405-418. Proc. 26th Annual Larv. Fish Conf. Institute of Marine Research. Bergen, Norway.
  • Ditty, JG, Shaw, RF & LA Fuiman. 2005. Larval development of five species of blenny (Teleostei: Blenniidae) from the western North Atlantic, with a synopsis of blennioid family characters. J. Fish Biol. 66: 1261-1284.
  • Labelle, M & JR Nursall. 1992. Population biology of the redlip blenny, Ophioblennius atlanticus macclurei (Sylvester) in Barbados. Bull. Mar. Sci. 50: 186-204.
  • Lindquist, DG & RM Dillaman. 1986. Trophic morphology of four western Atlantic blennies (Pisces: Blenniidae). Copeia. 1986: 207-213.
  • Longley, WH & SF Hildebrand. 1941. Systematic catalogue of the fishes of Tortugas, Florida with observations on color and local distribution. Papers Tortugas Lab. 34: 1-331.
  • Randall, JE. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Ocean. Miami. 5: 665-847.
  • Rooker, JR, Dokken, QR, Pattengill, CV & GJ Holt. 1997. Fish assemblages on artificial and natural reefs in the Flower Garden Banks National Marine Sanctuary, USA. Coral Reefs. 16: 83-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

No median row of cirri; supraorbital cirri branched (Ref. 26938). With numerous small brown spots; small black spot at front of dorsal fin; edge of anal fin pale (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Look Alikes

Learn more about this article

Several species of combtooth blennies inhabit the IRL and surrounding coastal waters. Of these, the most closely related and morphologically similar species are the pearl blenny, Entomacrodus nigricans; and the molly miller, Scartella cristata (Robins & Ray 1986). The dorsal fin of the pearl blenny is deeply notched, with the spinous section low and straight-edged. The body is brown with irregular large dark brown bars, blackish and pearly white spots. Dark bands are also present on the lips and cheeks. The maximum size of E. nigricans is 10 cm, slightly larger than the seaweed blenny. The molly miller also reaches lengths of 10 cm, but has a row of comb-like cirri down the middle of the head anterior to the dorsal fin. Like P. marmoreus, the cirrus above each eye is branched. The body is olive brown with darker markings and occasional pearly white spots, and the caudal fin is usually barred.
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Bath, H. 1977. Revision der Blenniini (Pisces: Blenniidae). Senckenberg. Biol. 57: 167-234.
  • Bath, H. 1990. Taxonomie und Verbreitung von Parablennius Ribeiro 1915 an der W Kuste Afrikas und Kapverdischen Inseln mit Revalidation von P. verryckeni (Poll 1959) und Beschreibung drei neuer Arten. Senckenberg. Biol. 70: 15-69.
  • Ditty, JG. 2002. Ontogeny and intervals of development in five reef-associated species of blenny from the northern Gulf of Mexico (Teleostei: Blenniidae). PhD Dissertation. LA State Univ. USA. 168 pp.
  • Ditty, JG, Fuiman, LA & RF Shaw. 2003. Characterizing natural intervals of development in the early life of fishes: an example using blennies (Teleostei: Blenniidae). In: Browman, HI & AB Skiftesvik. The big fish bang. 405-418. Proc. 26th Annual Larv. Fish Conf. Institute of Marine Research. Bergen, Norway.
  • Ditty, JG, Shaw, RF & LA Fuiman. 2005. Larval development of five species of blenny (Teleostei: Blenniidae) from the western North Atlantic, with a synopsis of blennioid family characters. J. Fish Biol. 66: 1261-1284.
  • Labelle, M & JR Nursall. 1992. Population biology of the redlip blenny, Ophioblennius atlanticus macclurei (Sylvester) in Barbados. Bull. Mar. Sci. 50: 186-204.
  • Lindquist, DG & RM Dillaman. 1986. Trophic morphology of four western Atlantic blennies (Pisces: Blenniidae). Copeia. 1986: 207-213.
  • Longley, WH & SF Hildebrand. 1941. Systematic catalogue of the fishes of Tortugas, Florida with observations on color and local distribution. Papers Tortugas Lab. 34: 1-331.
  • Randall, JE. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Ocean. Miami. 5: 665-847.
  • Rooker, JR, Dokken, QR, Pattengill, CV & GJ Holt. 1997. Fish assemblages on artificial and natural reefs in the Flower Garden Banks National Marine Sanctuary, USA. Coral Reefs. 16: 83-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

reef-associated; marine; depth range 0 - 10 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Inhabits eroded basins and limestone boulders covered by an algal mat, sea fans, etc. Sometimes around mangrove roots, young are sometimes found in floating Sargassum.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 121 specimens in 1 taxon.
Water temperature and chemistry ranges based on 70 samples.

Environmental ranges
  Depth range (m): 0 - 135
  Temperature range (°C): 10.137 - 27.601
  Nitrate (umol/L): 0.286 - 11.406
  Salinity (PPS): 34.217 - 37.169
  Oxygen (ml/l): 3.728 - 5.023
  Phosphate (umol/l): 0.053 - 0.969
  Silicate (umol/l): 0.805 - 7.366

Graphical representation

Depth range (m): 0 - 135

Temperature range (°C): 10.137 - 27.601

Nitrate (umol/L): 0.286 - 11.406

Salinity (PPS): 34.217 - 37.169

Oxygen (ml/l): 3.728 - 5.023

Phosphate (umol/l): 0.053 - 0.969

Silicate (umol/l): 0.805 - 7.366
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

 

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 0 - 10m.
Recorded at 10 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Migration

Learn more about this article

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Inhabits eroded basins and limestone boulders covered by an algal mat, sea fans, etc. (Ref. 5521). Sometimes around mangrove roots, young are sometimes found in floating Sargassum (Ref. 26938). Omnivorous, but feeds mostly on algae (Ref. 13442). Classified as a planktivore (Ref. 42240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

The seaweed blenny uses its beak-like lower jaw to pick at organisms on the benthos and among fouling communities. Common prey items and other foods include a variety of polychaetes, crustaceans, hydroids and algae (Lindquist & Dillaman 1986, Longley & Hildebrand 1941, Randall 1967).Predators: While information regarding specific predators of the seaweed blenny is scarce, it is likely that this species is preyed upon by larger demersal fishes and crustaceans such as crabs and lobsters. Activity Time: Like other combtooth blennies, P. marmoreus is diurnal, actively feeding and engaging in other behaviors during the day (Robins & Ray 1986, Rooker et al. 1997).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Bath, H. 1977. Revision der Blenniini (Pisces: Blenniidae). Senckenberg. Biol. 57: 167-234.
  • Bath, H. 1990. Taxonomie und Verbreitung von Parablennius Ribeiro 1915 an der W Kuste Afrikas und Kapverdischen Inseln mit Revalidation von P. verryckeni (Poll 1959) und Beschreibung drei neuer Arten. Senckenberg. Biol. 70: 15-69.
  • Ditty, JG. 2002. Ontogeny and intervals of development in five reef-associated species of blenny from the northern Gulf of Mexico (Teleostei: Blenniidae). PhD Dissertation. LA State Univ. USA. 168 pp.
  • Ditty, JG, Fuiman, LA & RF Shaw. 2003. Characterizing natural intervals of development in the early life of fishes: an example using blennies (Teleostei: Blenniidae). In: Browman, HI & AB Skiftesvik. The big fish bang. 405-418. Proc. 26th Annual Larv. Fish Conf. Institute of Marine Research. Bergen, Norway.
  • Ditty, JG, Shaw, RF & LA Fuiman. 2005. Larval development of five species of blenny (Teleostei: Blenniidae) from the western North Atlantic, with a synopsis of blennioid family characters. J. Fish Biol. 66: 1261-1284.
  • Labelle, M & JR Nursall. 1992. Population biology of the redlip blenny, Ophioblennius atlanticus macclurei (Sylvester) in Barbados. Bull. Mar. Sci. 50: 186-204.
  • Lindquist, DG & RM Dillaman. 1986. Trophic morphology of four western Atlantic blennies (Pisces: Blenniidae). Copeia. 1986: 207-213.
  • Longley, WH & SF Hildebrand. 1941. Systematic catalogue of the fishes of Tortugas, Florida with observations on color and local distribution. Papers Tortugas Lab. 34: 1-331.
  • Randall, JE. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Ocean. Miami. 5: 665-847.
  • Rooker, JR, Dokken, QR, Pattengill, CV & GJ Holt. 1997. Fish assemblages on artificial and natural reefs in the Flower Garden Banks National Marine Sanctuary, USA. Coral Reefs. 16: 83-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Associations

Learn more about this article

No known obligate associations exist for P. marmoreus. However, as inhabitants of a variety of coastal ecosystems, seaweed blennies are associated with several organisms common to seagrass beds, oyster reefs, rocky intertidal zones and nearshore reefs. For extensive lists of other species found throughout the ecosystems in which P. marmoreus occurs, please refer to the "Habitats of the IRL" link at the left of this page.
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Bath, H. 1977. Revision der Blenniini (Pisces: Blenniidae). Senckenberg. Biol. 57: 167-234.
  • Bath, H. 1990. Taxonomie und Verbreitung von Parablennius Ribeiro 1915 an der W Kuste Afrikas und Kapverdischen Inseln mit Revalidation von P. verryckeni (Poll 1959) und Beschreibung drei neuer Arten. Senckenberg. Biol. 70: 15-69.
  • Ditty, JG. 2002. Ontogeny and intervals of development in five reef-associated species of blenny from the northern Gulf of Mexico (Teleostei: Blenniidae). PhD Dissertation. LA State Univ. USA. 168 pp.
  • Ditty, JG, Fuiman, LA & RF Shaw. 2003. Characterizing natural intervals of development in the early life of fishes: an example using blennies (Teleostei: Blenniidae). In: Browman, HI & AB Skiftesvik. The big fish bang. 405-418. Proc. 26th Annual Larv. Fish Conf. Institute of Marine Research. Bergen, Norway.
  • Ditty, JG, Shaw, RF & LA Fuiman. 2005. Larval development of five species of blenny (Teleostei: Blenniidae) from the western North Atlantic, with a synopsis of blennioid family characters. J. Fish Biol. 66: 1261-1284.
  • Labelle, M & JR Nursall. 1992. Population biology of the redlip blenny, Ophioblennius atlanticus macclurei (Sylvester) in Barbados. Bull. Mar. Sci. 50: 186-204.
  • Lindquist, DG & RM Dillaman. 1986. Trophic morphology of four western Atlantic blennies (Pisces: Blenniidae). Copeia. 1986: 207-213.
  • Longley, WH & SF Hildebrand. 1941. Systematic catalogue of the fishes of Tortugas, Florida with observations on color and local distribution. Papers Tortugas Lab. 34: 1-331.
  • Randall, JE. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Ocean. Miami. 5: 665-847.
  • Rooker, JR, Dokken, QR, Pattengill, CV & GJ Holt. 1997. Fish assemblages on artificial and natural reefs in the Flower Garden Banks National Marine Sanctuary, USA. Coral Reefs. 16: 83-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Population Biology

Learn more about this article

Little information is available on the abundance of P. marmoreus. However, surveys reported up to 30 individuals throughout twenty-seven 500 m3 transects on the artificial reefs of the Flower Garden Banks National Marine Sanctuary located in the northwestern Gulf of Mexico (Rooker et al. 1997).
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Bath, H. 1977. Revision der Blenniini (Pisces: Blenniidae). Senckenberg. Biol. 57: 167-234.
  • Bath, H. 1990. Taxonomie und Verbreitung von Parablennius Ribeiro 1915 an der W Kuste Afrikas und Kapverdischen Inseln mit Revalidation von P. verryckeni (Poll 1959) und Beschreibung drei neuer Arten. Senckenberg. Biol. 70: 15-69.
  • Ditty, JG. 2002. Ontogeny and intervals of development in five reef-associated species of blenny from the northern Gulf of Mexico (Teleostei: Blenniidae). PhD Dissertation. LA State Univ. USA. 168 pp.
  • Ditty, JG, Fuiman, LA & RF Shaw. 2003. Characterizing natural intervals of development in the early life of fishes: an example using blennies (Teleostei: Blenniidae). In: Browman, HI & AB Skiftesvik. The big fish bang. 405-418. Proc. 26th Annual Larv. Fish Conf. Institute of Marine Research. Bergen, Norway.
  • Ditty, JG, Shaw, RF & LA Fuiman. 2005. Larval development of five species of blenny (Teleostei: Blenniidae) from the western North Atlantic, with a synopsis of blennioid family characters. J. Fish Biol. 66: 1261-1284.
  • Labelle, M & JR Nursall. 1992. Population biology of the redlip blenny, Ophioblennius atlanticus macclurei (Sylvester) in Barbados. Bull. Mar. Sci. 50: 186-204.
  • Lindquist, DG & RM Dillaman. 1986. Trophic morphology of four western Atlantic blennies (Pisces: Blenniidae). Copeia. 1986: 207-213.
  • Longley, WH & SF Hildebrand. 1941. Systematic catalogue of the fishes of Tortugas, Florida with observations on color and local distribution. Papers Tortugas Lab. 34: 1-331.
  • Randall, JE. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Ocean. Miami. 5: 665-847.
  • Rooker, JR, Dokken, QR, Pattengill, CV & GJ Holt. 1997. Fish assemblages on artificial and natural reefs in the Flower Garden Banks National Marine Sanctuary, USA. Coral Reefs. 16: 83-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Oviparous, distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Reproduction

Learn more about this article

Like most other blennies, egg deposition and development occurs on the benthos. After fertilization is complete, all the females of a single male mate deposit eggs on a protected surface, such as: empty bivalve shells, holes in rocks, sponges, or inside discarded cans (Peters 1981). The parental male then guards the clutches until hatching (Labelle & Nursall 1992). Embryology & Larval Development: Information regarding the gestation period and embryology of P. marmoreus is lacking. Larvae range between 5.8 and 16.0 mm in length, bearing an average of 9 teeth. Once the larvae settle at a length of 19.0 to 20.5 mm, they have up to 22 teeth (Ditty et al. 2003, 2005). Pectoral fin pigmentation is generally absent until just before settlement (Ditty et al. 2005). Temperature &
  • Robins, CR & GC Ray. 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Co. New York. USA. 354 pp.
  • Bath, H. 1977. Revision der Blenniini (Pisces: Blenniidae). Senckenberg. Biol. 57: 167-234.
  • Bath, H. 1990. Taxonomie und Verbreitung von Parablennius Ribeiro 1915 an der W Kuste Afrikas und Kapverdischen Inseln mit Revalidation von P. verryckeni (Poll 1959) und Beschreibung drei neuer Arten. Senckenberg. Biol. 70: 15-69.
  • Ditty, JG. 2002. Ontogeny and intervals of development in five reef-associated species of blenny from the northern Gulf of Mexico (Teleostei: Blenniidae). PhD Dissertation. LA State Univ. USA. 168 pp.
  • Ditty, JG, Fuiman, LA & RF Shaw. 2003. Characterizing natural intervals of development in the early life of fishes: an example using blennies (Teleostei: Blenniidae). In: Browman, HI & AB Skiftesvik. The big fish bang. 405-418. Proc. 26th Annual Larv. Fish Conf. Institute of Marine Research. Bergen, Norway.
  • Ditty, JG, Shaw, RF & LA Fuiman. 2005. Larval development of five species of blenny (Teleostei: Blenniidae) from the western North Atlantic, with a synopsis of blennioid family characters. J. Fish Biol. 66: 1261-1284.
  • Labelle, M & JR Nursall. 1992. Population biology of the redlip blenny, Ophioblennius atlanticus macclurei (Sylvester) in Barbados. Bull. Mar. Sci. 50: 186-204.
  • Lindquist, DG & RM Dillaman. 1986. Trophic morphology of four western Atlantic blennies (Pisces: Blenniidae). Copeia. 1986: 207-213.
  • Longley, WH & SF Hildebrand. 1941. Systematic catalogue of the fishes of Tortugas, Florida with observations on color and local distribution. Papers Tortugas Lab. 34: 1-331.
  • Randall, JE. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Ocean. Miami. 5: 665-847.
  • Rooker, JR, Dokken, QR, Pattengill, CV & GJ Holt. 1997. Fish assemblages on artificial and natural reefs in the Flower Garden Banks National Marine Sanctuary, USA. Coral Reefs. 16: 83-92.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Parablennius marmoreus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTCGTATTCGGTGCCTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTACTTATTCGAGCCGAACTAAGCCAACCAGGAGCCCTTCTTGGAGACGATCAGATCTATAATGTAATCGTTACCGCCCACGCCTTCGTGATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGTTTTGGAAACTGACTCATCCCCCTTATGGTTGGGGCACCAGACATGGCGTTCCCACGAATGAATAACATGAGCTTCTGACTCTTACCCCCCTCATTCCTTCTTCTTCTAGCCTCCTCCGGAGTTGAAGCCGGTGCTGGAACAGGTTGAACTGTTTACCCCCCTCTGTCCGGAAACCTGGCGCACGCAGGGGCCTCCGTTGACCTAACTATTTTCTCTCTTCATTTAGCAGGGATTTCATCGATTCTTGGAGCTATTAATTTCATCACAACTATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAAACCCCTCTATTTGTATGGGCAGTACTAATCACAGCTGTACTACTTCTTCTATCATTACCCGTGCTAGCAGCCGGTATTACAATACTTCTGACAGATCGAAATTTAAACACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATTCTTTACCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Parablennius marmoreus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

National NatureServe Conservation Status

Learn more about this article

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

NatureServe Conservation Status

Learn more about this article

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Seaweed blenny

Learn more about this article

Parablennius marmoreus, the Seaweed blenny, is a species of combtooth blenny found in coral reefs in the western Atlantic ocean along the coasts of New York (USA), Bermuda, the Bahamas, also in the Gulf of Mexico, south to southern Brazil. This species reaches a length of 8.5 centimetres (3.3 in) TL.[1]

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2013). "Parablennius marmoreus" in FishBase. February 2013 version.
Stub iconThis Blenniidae article is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!