Overview

Comprehensive Description

Biology

Live in kelp and other seaweeds and over rocks. Found usually at depths shallower than 23 m but also caught at depths up to 73 m. Often form small groups, frequently well off bottom. When disturbed often burrows in bottom sediment. Sleep at night buried in sand with head protruding. Feed on a variety of small invertebrates and also picks parasites from other fishes that come to be cleaned. No sex reversal. Pelagic spawner (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known in the eastern Pacific from Salt Point in northern California to southern central Baja California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Salt Point in northern California, USA to southern central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 4 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Halichoeres californicus
Catalog Number: USNM 707
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Trowbridge
Locality: Island of San Miguel, Cal., California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Halichoeres californicus
Catalog Number: USNM 706
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Trowbridge
Locality: Monterey, Cal, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits rocky reefs and kelp forests in depths of 1-73 m, but is most common above 20 m. It feeds on small invertebrates and may act as a “cleaner” for larger fishes. It is likely a protogynous hermaphrodite.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 2 - 48
  Temperature range (°C): 13.090 - 13.090
  Nitrate (umol/L): 5.585 - 5.585
  Salinity (PPS): 33.416 - 33.416
  Oxygen (ml/l): 5.298 - 5.298
  Phosphate (umol/l): 0.736 - 0.736
  Silicate (umol/l): 6.795 - 6.795

Graphical representation

Depth range (m): 2 - 48
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oxyjulis californica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGACATTGGCACCCTTTATCTAGTATTTGGTGCCTGAGCTGGTATAGTCGGTACGGCCTTAAGCCTGCTTATTCGGGCTGAACTGAGCCAACCCGGCGCTCTCCTCGGAGATGACCAGATCTACAATGTAATCGTTACGGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTCGGAAACTGGCTAATTCCCCTAATGATCGGAGCCCCCGACATGGCCTTCCCTCGTATGAATAATATGAGCTTTTGACTCCTCCCTCCTTCGTTCCTTCTCCTCCTCGCTTCTTCTGGGGTAGAAGCAGGCGCCGGGACTGGCTGAACAGTCTACCCCCCTCTATCTGGGAATCTTGCCCACGCCGGTGCATCCGTCGACCTAACTATCTTTTCTCTCCACTTAGCCGGCATCTCTTCTATCTTAGGTGCCATCAACTTCATTACGACCATCATCAATATGAAACCCCCTGCAATCTCCCAATACCAGACGCCCCTGTTTGTCTGAGCTGTATTAATTACAGCAGTCTTACTGCTCCTCTCCCTACCCGTCCTTGCTGCTGGCATTACAATGCTTCTGACAGACCGAAATCTAAACACTACCTTCTTCGACCCGGCCGGAGGAGGAGACCCCATCCTATACCAGCACTTATTCTGATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oxyjulis californica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Craig, M.T.

Reviewer/s
Robertson, R. & Carpenter, K.E.

Contributor/s

Justification
This is a very common species throughout its range. There are no known major threats and it occurs in protected areas throughout its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is one of the most common wrasses in southern California. It reaches densities of up to 0.5 fish per m2, and is among the top three species recorded by fisheries independent diver surveys (Craig et al. unpublished data).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Oxyjulis californica

Oxyjulis californica is a species of wrasse native to the eastern Pacific Ocean along the coasts of California and Baja California. Its distribution extends from Salt Point in Sonoma County, California, to southern central Baja California,[1][2] near Cedros Island.[3] It is a very common species; its common name in Spanish is señorita.[1]

This fish can grow to 25 cm (9.8 in) in total length.[2][4][5] Its body is fusiform, frequently described as "cigar-shaped".[4][5][6] It is brown or shiny bronze[7] dorsally and orange on its sides, becoming paler ventrally. The base of the tail fin is mostly covered with a large black[3] or chocolate brown[6] spot. The mouth is small and it has protruding "buck teeth"[6][8] which it uses to scrape tiny invertebrate prey items off of kelp.[4]

This fish lives in near-coastal marine habitats, especially kelp forests and reefs. It has been observed at depths of 73 m (240 ft), but it generally lives at 20 m (66 ft) or less.[1] It may cruise in a small school, but if threatened, it often retreats to the bottom, digging into the substrate to hide. It also rests on the bottom at night, burrowing in backwards so only its head sticks out of the substrate.[2]

The diet of the fish is composed of invertebrates, including marine worms, bryozoans, crustaceans, dove snails, limpets, fish larvae, and squid.[3] It may consume small amounts of seaweed.[6] It also feeds on the ectoparasites of other fish. The señorita is a cleaner wrasse, a fish that grooms the parasites and other materials off the bodies of other fish.[2] It may remove and eat ectoparasites such as bacteria, copepods, and isopods.[3] Parasites can constitute around half its total food intake.[9] Sometimes when the señorita begins to clean one of its clients, a crowd of other fish will gather around to receive the service.[4] Species that seek the señorita for a grooming include the bat ray (Myliobatis californica), giant sea bass (Stereolepis gigas), kelp bass (Paralabrax clathratus), jacksmelt (Atherinopsis californiensis), topsmelt (Atherinops affinis), sargo (Diplodus sargus), blacksmith (Chromis punctipinnis), garibaldi (Hypsypops rubicundus), opaleye (Girella nigricans), halfmoon (Medialuna californiensis), and mola (Mola mola). The other fish may solicit the cleaning with their behavior. The garibaldi extends its gill slits to give the señorita access to parasites on its gills.[3] The blacksmith points its head down to encourage the cleaner,[10] and many blacksmith at a time may mob it, competing for its attention. They may even block its escape if it tries to leave the scene. The opaleye is usually constantly swimming, but it will stop and hold still if it meets a señorita. The kelp bass, a predator of small fish, will often refrain from eating the señorita, and let it clean.[3] While the señorita will often clean large, predatory fish, it is not always safe. It has been observed in the diet of the kelp bass, the bocaccio (Sebastes paucispinis), and the starry rockfish (S. constellatus), but it is not consumed as often as would be expected, considering its frequent close contact with predators. It might be unpalatable.[9] Predators that do eat the fish include Brandt's cormorant (Phalacrocorax penicillatus) and the California sea lion (Zalophus californianus).[4]

The reproductive biology of this fish is not well known. Some sources suggest it may be a protogynous hermaphrodite, with the male able to change sex and become female,[1] while others doubt this occurs in this species.[2][5][8] Spawning occurs in May through August. The eggs are pelagic, floating suspended in the water.[6]

The fish tends to return to favorite locations; in one experiment, señoritas were caught and then released a distance away, and most found their way back to their original home ranges.[11]

Fishermen generally do not seek this species as quarry, and it can be an annoyance when it steals bait off hooks.[4] While technically edible, it is not valuable as a food fish.[3]

References[edit]

  1. ^ a b c d e Craig, M.T. 2010. Oxyjulis californica. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 14 November 2013.
  2. ^ a b c d e Froese, Rainer and Pauly, Daniel, eds. (2013). "Oxyjulis californica" in FishBase. August 2013 version.
  3. ^ a b c d e f g Señorita, Oxyjulis californica (Günther). Calisphere. University of California. 2011.
  4. ^ a b c d e f Señorita. Animal Guide. Monterey Bay Aquarium. 2013.
  5. ^ a b c Señorita (Oxyjulis californica). Animal Fact Files. BBC. 2005.
  6. ^ a b c d e Fitch, J. E. and R. J. Lavenberg. Tidepool and Nearshore Fishes of California. University of California Press. 1975. pg. 79.
  7. ^ Señorita. Oregon Coast Aquarium, Newport.
  8. ^ a b Goodson, G. Fishes of the Pacific Coast: Alaska to Peru, Including the Gulf of California and the Galápagos Islands. Stanford University Press. 1988. pg. 107.
  9. ^ a b Côté, I. M. Evolution and Ecology of Cleaning Symbioses in the Sea. In: Barnes, M., et al. Oceanography and Marine Biology: An Annual Review: Volume 38. Taylor and Francis. 2003. pg. 328.
  10. ^ Allen, L. G. and M. H. Horn. The Ecology of Marine Fishes: California and Adjacent Waters. University of California Press. 2006. pg. 557.
  11. ^ Hartney, K. B. (1996). Site fidelity and homing behaviour of some kelp-bed fishes. Journal of Fish Biology 49(6) 1062-69.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!