Overview

Comprehensive Description

Biology

Live in kelp and other seaweeds and over rocks. Found usually at depths shallower than 23 m but also caught at depths up to 73 m. Often form small groups, frequently well off bottom. When disturbed often burrows in bottom sediment. Sleep at night buried in sand with head protruding. Feed on a variety of small invertebrates and also picks parasites from other fishes that come to be cleaned. No sex reversal. Pelagic spawner (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known in the eastern Pacific from Salt Point in northern California to southern central Baja California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Salt Point in northern California, USA to southern central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 4 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Halichoeres californicus
Catalog Number: USNM 707
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Trowbridge
Locality: Island of San Miguel, Cal., California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Halichoeres californicus
Catalog Number: USNM 706
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Trowbridge
Locality: Monterey, Cal, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits rocky reefs and kelp forests in depths of 1-73 m, but is most common above 20 m. It feeds on small invertebrates and may act as a “cleaner” for larger fishes. It is likely a protogynous hermaphrodite.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 2 - 48
  Temperature range (°C): 13.090 - 13.090
  Nitrate (umol/L): 5.585 - 5.585
  Salinity (PPS): 33.416 - 33.416
  Oxygen (ml/l): 5.298 - 5.298
  Phosphate (umol/l): 0.736 - 0.736
  Silicate (umol/l): 6.795 - 6.795

Graphical representation

Depth range (m): 2 - 48
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oxyjulis californica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGACATTGGCACCCTTTATCTAGTATTTGGTGCCTGAGCTGGTATAGTCGGTACGGCCTTAAGCCTGCTTATTCGGGCTGAACTGAGCCAACCCGGCGCTCTCCTCGGAGATGACCAGATCTACAATGTAATCGTTACGGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTCGGAAACTGGCTAATTCCCCTAATGATCGGAGCCCCCGACATGGCCTTCCCTCGTATGAATAATATGAGCTTTTGACTCCTCCCTCCTTCGTTCCTTCTCCTCCTCGCTTCTTCTGGGGTAGAAGCAGGCGCCGGGACTGGCTGAACAGTCTACCCCCCTCTATCTGGGAATCTTGCCCACGCCGGTGCATCCGTCGACCTAACTATCTTTTCTCTCCACTTAGCCGGCATCTCTTCTATCTTAGGTGCCATCAACTTCATTACGACCATCATCAATATGAAACCCCCTGCAATCTCCCAATACCAGACGCCCCTGTTTGTCTGAGCTGTATTAATTACAGCAGTCTTACTGCTCCTCTCCCTACCCGTCCTTGCTGCTGGCATTACAATGCTTCTGACAGACCGAAATCTAAACACTACCTTCTTCGACCCGGCCGGAGGAGGAGACCCCATCCTATACCAGCACTTATTCTGATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oxyjulis californica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Craig, M.T.

Reviewer/s
Robertson, R. & Carpenter, K.E.

Contributor/s

Justification
This is a very common species throughout its range. There are no known major threats and it occurs in protected areas throughout its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is one of the most common wrasses in southern California. It reaches densities of up to 0.5 fish per m2, and is among the top three species recorded by fisheries independent diver surveys (Craig et al. unpublished data).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!