Overview

Comprehensive Description

Biology

Inhabits shallow coastal reefs and seagrass flats (Ref. 9710), also in algae-rocky reef flats and lagoons (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Sri Lanka to Fiji (Ref. 9710) and Tonga (Ref. 53797), north to Taiwan, south to northern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found in the Indo-Pacific from Sri Lanka and the Andaman Sea (R Myers pers. comm. 2009) east to Tonga including the Indo-Malay Archipelago, north to Ryuku Islands and south as far as Queensland in Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 11 - 12; Vertebrae: 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 2272))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Young green when in seagrasses and greenish brown on reefs. Recognized by the unusual color patterns on the cheek or the black spotted scales over the back (Ref. 48636). Preserved male specimens with pale spots on scales; dark spot behind eye (continuous with a bifurcating dark band which extends ventrally); another on opercle; a dark band on snout from upper lip to eye; head with bands; spot on upper caudal base may be present or absent (present in females). Anterior lateral line scales with 1-3 pores (usually 2); 5-6 suborbital pores. Anterior dorsal and anal soft rays longer than posterior rays; pelvic fins of males relatively short, not reaching anus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits shallow coastal reefs and seagrass beds in shallow waters from 1-10 m (Kuiter 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 0.2 - 6.1
  Temperature range (°C): 24.633 - 29.325
  Nitrate (umol/L): 0.139 - 0.580
  Salinity (PPS): 32.019 - 35.547
  Oxygen (ml/l): 4.202 - 4.883
  Phosphate (umol/l): 0.083 - 0.415
  Silicate (umol/l): 0.974 - 5.552

Graphical representation

Depth range (m): 0.2 - 6.1

Temperature range (°C): 24.633 - 29.325

Nitrate (umol/L): 0.139 - 0.580

Salinity (PPS): 32.019 - 35.547

Oxygen (ml/l): 4.202 - 4.883

Phosphate (umol/l): 0.083 - 0.415

Silicate (umol/l): 0.974 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoeres argus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGGGCCTGAGCCGGAATAGTGGGGACAGCCCTGAGCTTGCTTATTCGAGCTGAATTAAGCCAGCCCGGTGCCCTTCTCGGTGACGACCAGATTTATAACGTAATCGTCACTGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCTATTATGATTGGTGGGTTCGGAAACTGACTTATTCCCTTAATAATTGGAGCCCCCGATATGGCCTTCCCCCGAATAAATAATATAAGCTTTTGACTCTTGCCCCCATCCTTTCTACTACTTCTGGCCTCCTCAGGCGTAGAGGCGGGTGCAGGAACTGGCTGAACCGTGTATCCCCCCCTAGCAGGCAATCTGGCCCATGCAGGGGCTTCCGTAGACCTAACCATTTTTTCCCTCCATTTAGCCGGAATTTCCTCAATCCTAGGGGCTATCAACTTTATTACTACTATCATCAATATAAAACCCCCTGCTATCTCACAATATCAAACACCGCTCTTCGTTTGAGCTGTCCTAATTACCGCCGTACTGCTTCTTCTCTCACTTCCTGTCTTAGCTGCCGGCATTACAATACTGCTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCTGCGGGGGGAGGTGATCCAATCCTTTATCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres argus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and common. There are no known threats. This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no available data on the population of this species. It is one of a number of small abundant reef associated wrasses in this genus.

In Pangkor Island, Malaysia, a mean density of 1.33 individuals from three 100m X 2m transects was recorded in underwater fish visual surveys (Y. Yusuf unpublished data).

On the east coast of Peninsular Malaysia, a mean density of 1.35 individuals from twenty 50m X 5m transects was recorded in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no known major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures in place but probably occurs in some MPAs within its distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!