Overview

Brief Summary

Biology

The minnow lives in groups and feeds on plant debris, algae, molluscs, insects and crustaceans (4). The spawning season lasts from April to June (2); during this time they undertake short upstream migrations to spawn in shallow, gravelly areas (4). The minnow is an important component of the diet of larger fishes, including the brown trout (Salmo trutta fario), as well as many water birds (3). This species is a good 'indicator' of the quality and oxygen content of streams and rivers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The minnow is a small, lively freshwater fish, with a greenish-brown back (2), which features darker spots that form an attractive 'banded' effect (3). It has fairly large eyes, a small mouth and a blunt nose (2). During the spawning season, males develop spectacular colours; the back becomes dark, the sides golden and the belly and lower fins turn bright red (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Gregarious (Ref. 2196). Found in a wide range of cold and well oxygenated habitats from small, fast-flowing streams to large Nordic lowland rivers and from small upland lakes to large oligotrophic lakes. Usually occurs in association with salmonid fishes (Ref. 59043). Feeds on algae, plant debris (in rivers), mollusks, crustaceans and insects (Ref. 30578). Spawns over clean gravel areas in flowing water or on wave-washed shores of lakes. Overwinters in coarse substrate or in deep pools with low current (Ref. 59043). Migrates upstream for spawning in shallow gravel areas. Important laboratory fish, for research on sensory organs of fishes. Mean maximum age is 6 years (Ref. 41616). Locally threatened due to pollution and excessive stocking of species of Salmo (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Basins of Atlantic, North and Baltic Seas, Arctic and northern Pacific Ocean from Garonne (France) eastward to Anadyr and Amur drainages and Korea, Ireland (possibly introduced), Great Britain northward to 58°N, Scandinavia and Russia northernmost extremity, Rhône drainage. Recorded from upper and middle Volga and Ural drainages, Lake Balkhash (Kazakhstan) and upper Syr-Darya drainage (Aral basin), but these identifications require confirmation. Introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eurasia: basins of Atlantic, North and Baltic Seas, Arctic and northern Pacific Ocean, from Garonne (France) eastward to Anadyr and Amur drainages and Korea; Ireland (possibly introduced), Great Britain northward to 58°N. Scandinavia and Russia northernmost extremity, Rhône drainage. Recorded from upper and middle Volga and Ural drainages, Lake Balkhash (Kazakhstan) and upper Syr-Darya drainage (Aral basin), but else identifications need verification. At least one country reports adverse ecological impact after introduction. Several species are confused under Phoxinus phoxinus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Widespread in Europe and Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The minnow is found throughout much of Europe, from Britain to eastern Spain and eastern Siberia (4). It is widespread in Britain, but is absent from north Scotland (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 6 - 8; Analspines: 3; Analsoft rays: 6 - 8; Vertebrae: 38 - 40
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 140 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 556)); max. reported age: 11 years (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosed from its congeners in Europe by having lateral line usually reaching beyond anal fin base, a midlateral row of vertically elongated blotches whose depth is about 1/3-1/2 of body depth at same position, often fused in a midlateral stripe (in preserved individuals), caudal peduncle depth 2.6-3.1 times in its length, patches of breast scales separated by unscaled area or (rarely) connected anteriorly by 1-2 rows of scales, snout length 29-34% HL ( 1.1-1.4 times eye diameter), and anal fin origin in front of base of last dorsal ray (Ref. 59043). Caudal fin with 19 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
A wide range of cold and well oxygenated habitats from small, fast-flowing streams to large Nordic lowland rivers and from small upland lakes to large oligotrophic lakes. Usually associated with salmonid fishes. Spawning takes place over clean gravel areas in flowing water or on wave-washed shores of lakes. Overwinters in coarse substrate or in deep pools with low current.

Biology:
Gregarious, rheophilous. Lives up to 11 years, usually up to 4-5 years. Spawns for the first time at two years. Spawns in April-June at temperatures above 10°C. Some individuals spawn even during autumn. Spawns in shoals, fractional spawner, females deposit the sticky eggs deep into clean gravel. Feeds on invertebrates, algae and detritus.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish; pH range: 7.0 - 7.5; dH range: 10 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.55 - 1

Graphical representation

Depth range (m): 0.55 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits clean streams and rivers that have either a sandy or stony bed (2), in cold, running or still water that is well oxygenated (4). It reaches altitudes of 2000 m, and has been found in some lakes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Species has herbivorous-detritivorous tendencies (Ref. 12053).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Phoxinus phoxinus (Phoxinus phoxinus (2.0-2.9 mm)) preys on:
Baetis
Chimarrha marginata
Chironomidae
Bacillariophyceae
algae
plant tissue
detritus
protozoa
Diptera
Entomostraca
Collembola

Based on studies in:
Wales, Dee River (River)

This list may not be complete but is based on published studies.
  • R. M. Badcock, 1949. Studies in stream life in tributaries of the Welsh Dee. J. Anim. Ecol. 18:193-208, from pp. 202-206 and Price, P. W., 1984, Insect Ecology, 2nd ed., New York: John Wiley, p. 23
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Males and females form school separately and arrive on the spawning site at differen times. Spawn over clean gravel areas in flowing water or on wave-washed shores of lakes. Females lay sticky eggs deep into clean gravel (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Phoxinus phoxinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 102
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Phoxinus phoxinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATGGTAGGGACCGCCCTAAGCCTTCTTATTCGGGCCGAACTAAGCCAGCCGGGATCACTCCTAGGTGATAGCCAAATTTATAATGTTATTGTTACCGCCCATGCCTTCGTAATAATTTTCTTTATAGTCATGCCAATTCTTATTGGCGGATTTGGAAACTGGCTTGTACCTCTAATAATTGGTGCACCTGACATAGCCTTTCCCCGAATAAATAATATAAGCTTTTGACTTCTACCCCCATCATTCCTTCTTCTACTAGCTTCTTCTGGTGTTGAGGCTGGGGCCGGAACAGGTTGAACCGTATATCCCCCACTCGCAGGCAACCTTGCCCATGCAGGTGCATCAGTAGATCTTACGATCTTCTCGCTTCACCTAGCAGGTGTGTCATCAATTTTAGGGGCAGTCAACTTTATTACTACAATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAAACACCTCTCTTCGTCTGGGCCGTGCTCGTAACAGCCGTCCTACTTCTACTATCCCTGCCAGTGTTAGCTGCCGGTATTACAATGCTTCTTACAGATCGTAATCTTAATACCACATTCTTTGATCCTGCGGGAGGAGGAGACCCAATTTTATACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Contributor/s

Justification
A widespread species but locally threatened by pollution and excessive stocking of species of Salmo.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common and widespread.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Pollution and excessive stocking of species of Salmo.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common minnow

The Eurasian minnow,[1] minnow,[2] or common minnow (Phoxinus phoxinus) is a small species of freshwater fish in the carp family Cyprinidae. It is the type species of genus Phoxinus. It is ubiquitous throughout much of Eurasia, from Britain and Spain to eastern Siberia, predominantly in cool (12–20 °C) streams and well-oxygenated lakes and ponds. It is noted for being a gregarious species, shoaling in large numbers.

Characteristics[edit]

  • Size: 8 – 10 cm
  • Habitat: Common in fast-flowing, well oxygenated fresh water and well-drained vegetated ponds. Present in Scotland.
  • Identification: Small, slender, dark-coloured with blunt snout and small scales. Belly is cream to pearly, changing in male to red in spawning season where the males also have tubercles.
  • Similar species: gudgeon, which is lighter in colour and has small barbels. Largest length is 15 centimetres.

In Germany the Eurasian minnow is very seldom encountered and stands under protection.

Behavior[edit]

Shoaling[edit]

Shoaling and schooling behavior of common minnows occur early in their development, as soon as they become capable of swimming. Shoaling behavior then increases and becomes dominant by three to four weeks after its emergence.[3] This behavior generally benefits individual minnows by improving predator avoidance and foraging. However, there are also costs of living in groups such as increased competition for food and risk of infection. Shoaling behavior is modified depending on the situation such as presence of predators or resource availability.[4]

Predator avoidance[edit]

The group formation of common minnows can be explained by the selfish herd effect proposed by W.D. Hamilton. According to the selfish herd theory, a group forms as individuals try to reduce their domain of danger by approaching others and continuously moving toward the center of the group where the risk of predation is the lowest.[5] As the theory predicts, common minnows increase their shoaling behavior in response to increased predation pressure.

Alarm substance[edit]

Common minnows can detect the predators’ presence and communicate with their shoalmates by a chemical signal that is detected by olfactory nerves. The chemical, named Schreckstoff after a German word meaning "fear substance" by Karl von Frisch who first described it, is contained in specialized skin cells called alarm substance cells and is released from an injured or killed minnow.[6] The shoalmates can detect the chemical and respond to the increased risk of predation.

The production and release of this alarm substance are altruistic because the sender of the signal, who does not directly benefit from the signal released upon its injury, has to pay the cost for the production and release of the chemical. In fact, the alarm substance cells decrease in number when the common minnows are in poor physical condition due to scarce food, indicating that there is metabolic cost for producing and maintaining the specialized cells.[7] The apparent altruistic behavior is not clearly understood, because the likely explanation of kin selection is not supported by the shoal structure of common minnows in which shoalmates are not necessarily closely related.[8]

Shoaling adjustment in response to predation risk[edit]

When common minnows sense the alarm substance, they form tighter shoals as individuals move to be in the central position in their shoaling group. However, in an experiment where common minnows were habituated to the chemical by continuous exposure, common minnows did not react to the signal. Only the naïve common minnows reacted to the signal by relocating themselves to the central position in the group.[9] In another experiment, researchers observed common minnows in semi-natural setting and found that common minnows’ shoaling behavior varies depending on the habitat’s complexity. Minnows tend to respond to increased predation risk by forming larger shoals in structurally simple habitats and by reducing their rate of movement in complex habitats.[10]

Predator inspection[edit]

When potential predators come near the shoal, some common minnows take the risk of approaching the predators in order to inspect the predator and assess the danger. Predator inspection behavior increases the risk of being attacked and eaten by the predator, but the behavior is beneficial to the inspectors as more alert minnows react more quickly to the attack of the predator. Common minnows are expected to recognize predators by their appearance. In an experiment, common minnows inspected a realistic-looking model of a pike, one of the major predators of minnows, and a simple cylinder model. Common minnows showed high level of alertness, such as low feeding rate and frequent skittering after their visit to the realistic model, but they became easily habituated to the simple model and resumed foraging even in proximity to the model.[11]

In addition to identifying predators by their appearance, common minnows can respond to the predators’ motivation to attack. In an experiment, common minnows inspected a northern pike behind a clear partition at regular intervals until the pike tried to attack the minnows. Their responses differed depending on when their visit was made. Minnows that inspected the pike just before the pike attacked were more alarmed than those who inspected the pike long before the attack. The observation shows that common minnows can detect the predator’s impending aggressiveness and motivation to attack.[12]

Variations in anti-predator activities[edit]

Different populations of common minnows show varying degrees of anti-predatory activities. Common minnows from populations in high-predation areas usually show more intense predator inspection than those from low-predation areas. They tend to commence inspection sooner, form larger group of inspectors, inspect more frequently, and approach less to the predator.[11]

Some components of anti-predator activities are inherited, as indicated in the early emergence of shoaling behavior in laboratory-raised immature minnows. The varying levels of predator inspection and shoaling behavior in response to predator’s presence can arise in laboratory-raised minnows even though they do not have any experience of predators. Their anti-predatory behaviors are qualitatively and quantitatively similar to their wild-caught counterparts. Anti-predatory behaviors are modified by early experience of predators. Early exposure to predators increases the inspection rate and shoaling tendency.[13]

Foraging[edit]

Shoaling behavior improves foraging success, because the demand for anti-predatory activities per individual is reduced and because more individuals scanning for food leads to quicker detection. In general, a larger shoal of fish locates food faster, which was confirmed to be true in common minnows.[14]

Individual recognition and shoal choice[edit]

Common minnows do not randomly choose shoalmates to forage with. They tend to associate with familiar shoalmates [15] and prefer to form shoals with poor competitors for food,[16] which indicates that they can recognize individual conspecifics. It is more beneficial to shoal with poor competitors because while group foraging helps the search for food, it also leads to competition for food among the shoalmates. Common minnows tend to associate with familiar shoalmates, but new alliances can form when different groups encounter. In an experiment in which common minnows from different groups were introduced to a common environment and monitored, they associated significantly more frequently with familiar individuals than unfamiliar individuals. The preference lasted up to two weeks, but by the third week, new association patterns were observed.[17]

Breeding in captivity[edit]

The Eurasian minnow breeds well in cold fresh water aquariums, but it is rarely sold as an aquarium fish. They need a good supply of oxygen (some air bubblers do fine), a reasonable current (which is often provided by the bubblers if they are good strong ones), and a gravel bottom. It is not clear what size works best although smallish (0.5 cm each) works well. Clean water helps and so do plant life and general good quality aquarium conditions. Breeding begins around late May when the fish become noticeably more active, and the fish begin to change colour. The females don't change their colour so much, more the shape of their body; in fact the colours seem to fade if anything except for the fins which become slightly more red. Their body becomes more deep set toward the abdomen, which area also starts bulking out. Although the changes in the female are small, the changes in the male are huge. First of all, the difference in the shades of colour on the fish become stronger (dark gets darker, light gets lighter), and the fins, throat and some other areas redden. These colour changes strengthen as the fish gets closer to breeding. The body becomes much bulkier, and the gills become very pale with iridescent light blue patches towards the bottom and below. This contrasts with the now very dark body. Later the scales on the lower half of the body begin to stand out more and become slightly gold-lined. All these strengthen as time passes on. All the fins, especially the dorsal, start to stick out more; this happens in both sexes. The males begin to chase females around, rubbing their sides against them, and this becomes very frenzied and aggressive towards the mating. Mating happens when this behaviour reaches its climax where the female releases the eggs and the male fertilizes them.

Minnows shoaling in the shallows at Eglinton Country Park in Scotland

Fertilised eggs promptly sink to the bottom and into the gravel. The other fish will start eating the eggs and picking at the gravel to find them. The male will then ferociously guard them for a period of time. A few days later the eggs will hatch and the fry will emerge. It is very important to have much plant cover for the fry to hide in as the adult fish will try to eat them especially if underfed and if not much other live food is given. The baby fry feed on small organisms called infusoria and algae. To grow infusoria for feeding just get a jam jar of pond water and run it through some cotton wool or muslin to get out any larger predatory organisms like daphnia which will eat the infusoria and add hay to the water. Leave it for a few days in a dimly lit room at about room temp. and when you next look you should see lots of tiny white dots in the water which, if looked at under a microscope reveal to be lots of types of infusoria in their millions. these can be fed to the fry by adding them to the tank. To get more just add some of the old water containing the infusoria to cooled, boiled tap water with hay and repeat the other procedures. As the fry grow their diet changes. When they reach about half an inch they can be fed small organisms like daphnia or cyclops. These can be obtained by dragging a net through water where they can be seen or they can be purchased from aquarium dealers. Soon the fish will eat the same food as the adults and will quickly grow.

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2012). "Phoxinus phoxinus" in FishBase. May 2012 version.
  2. ^ Freyhof, J. & Kottelat, M. (2008). "Phoxinus phoxinus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 12 May 2012. 
  3. ^ Magurran, A.E. (1986). "The development of shoaling behaviour in the European minnow". Journal of Fish Biology 29: 159–169. 
  4. ^ Davies, N.B.; Krebs, J.R., West, S.A. (2012). An Introduction to Behavioral Ecology. Wiley-Blackwell. pp. 147–151. ISBN 9781405114165. 
  5. ^ Hamilton, W.D. (1971). "Geometry for the selfish herd". Journal of Theoretical Biology 31 (2): 295–311. 
  6. ^ Frisch, K. (1942). "Uber einen Schreckstoff der Fischhaut und seine biologische Bedeutung". Journal of Comparative Physiology 29: 46–145. 
  7. ^ Wisenden, B.D.; Smith, R.J.F. (1997). "The effect of physical condition and shoalmate familiarity on proliferation of alarm substance cells in the epidermis of fathead minnows". Journal of Fish Biology 50 (4): 799–808. 
  8. ^ Bernhardt, B.; Lampert, K.P.; Leese, F.; Mayer, C.; Tollrian, R. (2012). "Are shoals of minnow Phoxinus phoxinus formed by close kin?". Journal of Fish Biology 80: 713–721. 
  9. ^ Krause, J. (1993). "The effect of Schreckstoff on the shoaling behavior of the minnow – a test of Hamilton’s selfish herd theory". Animal Behaviour 45 (5): 1019–1024. 
  10. ^ Orpwood, J.E.; Magurran, A.E.; Armstrong, J.D.; Griffiths, S.W. (2008). "Minnows and the selfish herd: effects of predation risk on shoaling behaviour are dependent on habitat complexity". Animal Behaviour 76 (1): 143–152. 
  11. ^ a b Magurran, A.E.; Girling, S.L. (1986). "Predator model recognition and response habituation in shoaling minnows". Animal Behaviour 34 (2): 510–518. 
  12. ^ Murphy, K.E.; Pitcher, T.J. (1997). "Predator attack motivation influences the inspection behaviour of European minnows". Journal of Fish Biology 50 (2): 407–417. 
  13. ^ Magurran, A.E. (1990). "The inheritance and development of minnow anti-predator behavior". Animal Behaviour 39 (5): 834–842. 
  14. ^ Pitcher, T.J.; Magurran, A.E.; Winfield, I.J. (1982). "Fish in Larger Shoals Find Food Faster". Behavioral Ecology and Sociobiology 10 (2): 149–151. 
  15. ^ Griffiths, S.W. (1997). "Preferences for familiar fish do not vary with predation risk in the European minnow". Journal of Fish Biology 51: 489–495. 
  16. ^ Metcalfe, N.B.; Thomson, B.C. (1995). "Fish recognize and prefer to shoal with poor competitors". Proceedings of the National Academy of Sciences of the United States of America 259 (1355): 207–210. 
  17. ^ Griffiths, S.W.; Ojanguren, A.F.; Orpwood; Magurran, A.E.; Armstrong, J.D. (2007). "Familiarity-biased patterns of association shift with time among European minnows". Journal of Fish Biology 71 (6): 1602–1612. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!