Overview

Brief Summary

Zebrafish (Danio rerio) are small shoaling cyprinid fish. Although details of the distribution are unclear, D. rerio may be widely distributed in shallow, slow-flowing waters on the Indian subcontinent. They are most commonly encountered in shallow ponds and standing water bodies, often connected to rice cultivation. Where they are found, they tend to be among the most abundant fish species. (Spence et al. 2008 and references therein)

Danio rerio are omnivorous, feeding primarily on zooplankton and insects, although phytoplankton, filamentous algae and vascular plant material, spores and invertebrate eggs, fish scales, arachnids, detritus, sand, and mud have also been reported from gut content analyses (Spence et al. 2008 and references therein).

For many decades, D. rerio has been both a very popular aquarium fish and an important research model in several fields of biology (notably, developmental biology and toxicology). The development of D. rerio as a model organism for modern biological investigation began with the pioneering work of George Streisinger and colleagues at the University of Oregon (Streisinger et al. 1981; Briggs 2002), who recognized many of the virtues of D. rerio for research. Streisinger developed methods to produce homozygous strains by using genetically inactivated sperm, performed the first mutagenesis studies, and established that complementation methods (in which heterozygous mutant fish are paired) could be used to assign mutations to genetic complementation groups. Subsequently, the use and importance of D. rerio in biological research has exploded and diversified to the point that these fish are extremely important vertebrate models in an extraordinary array of research fields (see review by Runkwitz et al. 2011; Vascotto et al. 1997).

A number of features make D. rerio tractable for experimental manipulation. It is a small, robust fish, so large numbers can be kept easily and cheaply in the laboratory, where it breeds all year round. Females can spawn every 2 to 3 days and a single clutch may contain several hundred eggs. Generation time is short (for a vertebrate), typically 3 to 4 months, making it suitable for selection experiments. Danio rerio eggs are large relative to other fish (0.7 mm in diameter at fertilization) and optically transparent, the yolk being sequestered into a separate cell. Furthermore, fertilization is external so live embryos are accessible to manipulation and can be monitored through all developmental stages under a dissecting microscope. Development is rapid, with precursors to all major organs developing within 36 hours, and larvae display food-seeking and active avoidance behaviors within five days after fertilization, i.e., 2 to 3 days after hatching. Mutagenesis screens have now generated many thousands of mutations and have led to the identification of hundreds of genes controlling vertebrate development (Rinkwitz et al. 2011 report that as of their writing there was information on embryonic and larval expression of over 12,000 genes and just under 1000 mutant phenotypes). (Spence et al. 2008 and references therein) The D. rerio genome has now been largely sequenced (see http://www.sanger.ac.uk/Projects/D_rerio/), making it an even more valuable research organism. Although D. rerio is extremely well studied as a lab organism, the ecology and behavior of these fish in the wild has been far less well studied.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Adults inhabit streams, canals, ditches, ponds and beels (Ref. 1479). Occur in slow-moving to stagnant standing water bodies, particularly rice-fields (Ref. 4832); and lower reaches of streams (Ref. 58912). Common in rivulets at foot hills (Ref. 41236). Feed on worms and small crustaceans (Ref. 7020); also on insect larvae. Breed all year round (Ref. 58913). Appears to be primarily an annual species in the wild, the spawning season starting just before the onset of the monsoon (Ref. 72224). Domesticated zebrafish live on average 3.5 years, with oldest individuals surviving up to 5.5 years (Ref. 58923). Spawning is induced by temperature and commences at the onset of the monsoon season (Ref. 58913). Food availability also acts as cue for breeding (Ref. 58913). Growth rate is a vital guiding environmental factor for sexual differentiation for this species as observed in a study (Ref. 58948). In this same study, frequency and amount of food prior to and throughout gonadal differentiation period resulted in more individuals differentiating to become females and is more pronounced in hybrid than pure bred groups (Ref. 58948). Often used for mosquito control (Ref 6351). Popular for aquarium purposes (Ref. 44325). Used as a model system (=organism) for developmental biology (Ref. 47810). Aquarium keeping: in groups of 5 or more individuals; minimum aquarium size 60 cm (Ref. 51539).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zebrafish (Danio rerio) are small shoaling cyprinid fish native to the flood plains of the Indian subcontinent. The natural range of D. rerio is centered around the Ganges and Brahmaputra river basins in north-eastern India, Bangladesh, and Nepal, although in the past specimens have also been collected in the Indus, Cauvery, Pennar, Godavari, and Mahanadi river basins. There are also reports of occurrences from the Krishna river basin and the states of Rajasthan, Gujarat, and Andra Pradesh (river basins draining into the Arabian Sea) as well as northern Myanmar and Sri Lanka, but locality details are lacking. Although details of the distribution are unclear, D. rerio may be widely distributed in shallow, slow-flowing waters on the Indian subcontinent. Based on results from several studies, D. rerio occur in shallow water bodies with visibility to a depth of approximately 30 cm, frequently in unshaded locations with aquatic vegetation and a silty substratum. They are most commonly encountered in shallow ponds and standing water bodies, often connected to rice cultivation. Where they are found, they tend to be among the most abundant fish species. (Spence et al. 2008 and references therein)

Danio rerio are omnivorous, feeding primarily on zooplankton and insects, although phytoplankton, filamentous algae and vascular plant material, spores and invertebrate eggs, fish scales, arachnids, detritus, sand, and mud have also been reported from gut content analyses (Spence et al. 2008 and references therein).

The ‘‘leopard’’ danio, which displays a spotted color pattern rather than stripes, was originally thought to be a separate species, described as Brachydanio frankei (at one time, small Danio species with short dorsal fins and a reduced lateral line, including the species now known as Danio rerio, were segregated from the larger Danio species and placed in Brachydanio). However, neither molecular nor morphological analyses have differentiated between the two forms and hybrids have been shown to produce fertile progeny. The leopard danio is now known to be a spontaneous mutation of the wild-type D. rerio color pattern, with homozygotes displaying a spotted pattern and heterozygotes having a disrupted stripe pattern. Another aquarium variant is the ‘‘longfin’’ D. rerio, which is a dominant mutation resulting in elongated fins. The commonly used wild-type strain, TL (Tübingen long-fin) displays both the ‘‘leopard’’ and ‘‘longfin’’ mutations. (Spence et al. 2008 and references therein)

For many decades, D. rerio has been both a very popular aquarium fish and an important research model in several fields of biology (notably, toxicology and developmental biology; see, e.g., Creaser 1934). The development of D. rerio as a model organism for modern biological investigation began with the pioneering work of George Streisinger and colleagues at the University of Oregon (Streisinger et al. 1981; Briggs 2002), who recognized many of the virtues of D. rerio for research. Streisinger developed methods to produce homozygous strains by using genetically inactivated sperm, performed the first mutagenesis studies, and established that complementation methods (in which heterozygous mutant fish are paired) could be used to assign mutations to genetic complementation groups. Subsequently, the use and importance of D. rerio in biological research has exploded and diversified to the point that these fish are extremely important vertebrate models in an extraordinary array of research fields (see review by Runkwitz et al. 2011; Vascotto et al. 1997).

A number of features make D. rerio tractable for experimental manipulation. It is a small, robust fish, so large numbers can be kept easily and cheaply in the laboratory, where it breeds all year round. Females can spawn every 2 to 3 days and a single clutch may contain several hundred eggs. Generation time is short (for a vertebrate), typically 3 to 4 months, making it suitable for selection experiments. Danio rerio eggs are large relative to other fish (0.7 mm in diameter at fertilization) and optically transparent, the yolk being sequestered into a separate cell. Furthermore, fertilization is external so live embryos are accessible to manipulation and can be monitored through all developmental stages under a dissecting microscope. Development is rapid, with precursors to all major organs developing within 36 hours, and larvae display food seeking and active avoidance behaviors within five days after fertilization, i.e. 2 to 3 days after hatching. The large-scale random mutagenesis screens of D. rerio were the first to be conducted in a vertebrate. Danio rerio used for mutagenesis and screening are from lines that have been inbred for many generations in order to maintain a stable genetic background. Mutagenesis screens have now generated many thousands of mutations and have led to the identification of hundreds of genes controlling vertebrate development (Rinkwitz et al. 2011 report that as of their writing there was information on embryonic and larval expression of over 12,000 genes and just under 1000 mutant phenotypes). As a vertebrate, D. rerio has special value as a model of human disease and for the screening of therapeutic drugs (Chakraborty et al. 2009) and is often more tractable for genetic and embryological manipulation and cost effective than other vertebrate models such as mice. Hundreds of labs around the world now routinely use D. rerio in both basic and applied research, leading to the creation of a centralized online resource for this research community (http://zfin.org). Some researchers have even used D. rerio to investigate the genetic basis of vertebrate behavior (see, e.g., Miklósi and Andrew 2006; Norton and Bally-Cuif 2010). (Spence et al. 2008 and references therein) The D. rerio genome has now been largely sequenced (see http://www.sanger.ac.uk/Projects/D_rerio/), making it an even more valuable research organism.

Laale (1977) reviewed the D. rerio literature to date, with a focus on physiology. Wixon (2000) provides an overview of the current state of knowledge and resources for the study of D. rerio. Although D. rerio is extremely well studied as a lab organism, the ecology and behavior of these fish in the wild has been far less well studied. Spence et al. (2008) reviewed the ecology and behavior of D. rerio (see also McClure et al. 2006; Spence et al. 2006; Engeszer et al. 2007), as well as its taxonomic history, morphology, and many other aspects of its biology.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Asia: India, Nepal and Bangladesh; introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Asia: Pakistan, India, Bangladesh, Nepal and Myanmar (Ref. 41236). Reported from Bhutan (Ref. 40882). Appearance in Colombian waters presumably by escape from an aquarium fish rearing facility (Ref. 1739).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Danio rerio is a widely distributed species, known througout India to Nepal in the north and from Sutlej River in the west and in the east in West Bengal and Arunachal Pradesh.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Danio rerio is native to inland streams and rivers of India. Its has a broad geographic range in the Indian subcontinent, ranging from the Ganges and Brahmaputra river basins of Bangladesh, India, and Nepal. A few introduced populations of the species inhabit inland waters in the United States (California, Connecticut, Florida and New Mexico) and Columbia, South America.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Native ); neotropical (Introduced )

  • Boisen, A., J. Amstrup, I. Novak, M. Grosell. 2003. Sodium and chloride transport in soft water and hard water acclimated zebrafish (Danio rerio). Biochimica et Biophysica Acta, 1618: 207-218.
  • Mayden, R., K. Tang, K. Conway, J. Freyhof, S. Chamberlain, M. Haskins, L. Schneider, M. Sudkamp, R. Wood, M. Agnew, A. Bufalino, Z. Sulaiman, M. Miya, K. Saitoh, S. He. 2007. Phylogenetic Relationships of Danio Within the Order Cypriniformes: A Framework for Comparative and Evolutionary Studies of a Model Species. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution, 5: 642-654.
  • Nico, L., P. Fuller. 2009. "Brachydanio rerio" (On-line). USGS Nonindigenous Aquatic Species Database. Accessed March 31, 2011 at http://nas.er.usgs.gov/queries/FactSheet.aspx?speciesID=505.
  • Spence, R., G. Gerlach, C. Lawrence, C. Smith. 2008. The behaviour and ecology of the zebrafish, Danio rerio. Biological Reviews, 83: 13-34.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to eastern Asia (Pakistan, India, Bangladesh, and Nepal (Fuller et al. 1999). Introduced and established in McCauley Spring, Sandoval County, New Mexico; reported from Florida, California, and Connecticut (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 31 - 32
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Zebrafish have fusiform, laterally compressed bodies that reach an average length of 25 mm. The largest recorded zebrafish reached 64 mm in captivity. They have centrally located eyes and thin elongate mandibles with a protrusive lower jaw that causes the mouth to point upwards. Like other cyprinids, zebrafish are stomachless and toothless. As a result, they rely on gill rakers to break up food. Additionally, they are obligate suction feeders. Zebrafish have several defining features including an incomplete lateral line, two pairs of barbels, and several (usually 5 to 7) longitudinal stripes along the sides of their body. The degree of sexual dimorphism in zebrafish is minimal, as males tend to have more yellow coloration and tend to have larger anal fins than females.

Range length: 64 (in captivity) (high) mm.

Average length: 25 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male more colorful; sexes shaped differently

  • Albertson, R., T. Kocher. 2006. Genetic and developmental basis of cichlid trophic diversity. Heredity, 97: 211-221.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 60 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

3.8 cm SL (male/unsexed; (Ref. 41236))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Five uniformly, pigmented, horizontal stripes on the side of the body, all extending onto the end of caudal fin rays. Anal fin distinctively striped. Lateral line absent. Rostral barbels extend to anterior margin of orbit; maxillary barbels end at about middle of opercle. Branched anal fin rays 10-12. Vertebrae 31-32.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater; pH range: 6.0 - 8.0; dH range: 5 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

The species is an annual species. Adults inhabit streams, canals, ditches, ponds and beels occur in slow-moving to stagnant standing water bodies, particularly rice-fields and lower reaches of streams common in rivulets at foot hills. Feed on worms and small crustaceans, also on insect larvae. Breed all year round. Spawning is induced by temperature and commences at the onset of the monsoon season. Food availability also acts as cue for breeding.


Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zebrafish live in freshwater streams and rivers but are more often considered floodplain species. They are most often found in shallow, slow-moving water near the edge of streams or in ditches. Because of monsoon season in their native geographic range, zebrafish have adapted to a broad range of temperatures, from 6 degrees C during winter to 38 degrees C in summer. Rice cultivation by humans has had a significant impact on zebrafish habitat. Rice farming requires damming of waterways and creation of irrigation systems. Since rice farming is common in India, many natural habitats of zebrafish have been dramatically altered by damming and irrigation. Fortunately, zebrafish are relatively tolerant of human disturbance and are able to survive and reproduce well in altered habitats.

Habitat Regions: temperate ; tropical ; freshwater

Aquatic Biomes: rivers and streams

Other Habitat Features: agricultural

  • Engeszer, R., L. Patterson, A. Rao, D. Parichy. 2007. Zebrafish in the Wild: A Review of Natural History and New Notes from the Field. Zebrafish, 4: 21-40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Known from canals in California and Florida, from a spring in New Mexico, and from streams in Connecticut; these fishes probably came from fish farms or aquarium releases (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits streams, canals, ditches, ponds and beels (Ref. 1479). Occurs in slow-moving to stagnant standing water bodies, particularly rice-fields (Ref. 4832, 58912). Water highly transparent (Ref. 58912). Feeds on worms and small crustaceans (Ref. 7020); also on insect larvae and can be used for mosquito control (Ref 6351).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Zebrafish are omnivores. They get most of their food from the water column, mainly eating zooplankton and aquatic insects. Zebrafish also surface feed, eating terrestrial insects and arachnids. Zebrafish commonly eat mosquito larvae.

Animal Foods: eggs; insects; terrestrial non-insect arthropods; zooplankton

Plant Foods: algae; phytoplankton

Foraging Behavior: filter-feeding

Primary Diet: omnivore ; planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Zebrafish consume a number of insect species, including mosquito larvae. As a result, they likely help control insect pests throughout their geographic range. In addition, zebrafish are prey for a number of different piscivorous fish and bird species. There is no information available regarding parasites of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The main predators of zebrafish are snakeheads and freshwater garfish. Other predators include catfish, knifefish, spiny eels, Indian pond heron, and common kingfisher. Zebrafish show alarm in response to visual and olfactory predatorial cues. Anti-predator behavior is also triggered by injury pheromones. Alarm behaviors include increased agitation, aggression, and decreased feeding rates. Zebrafish have three pigment cell types that contribute to their stripes. One of the pigment cells, dark blue melanophores, can be altered in response to stimuli. This is believed to help zebrafish evade potential predators.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Plistophora Disease in neon fish. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ichthyobodo Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Olfaction, vision, and motion detection via the lateral line system help zebrafish perceive their local environment and evade potential predators. Movement in the surrounding water is detected by the lateral line, which can detect small changes in pressure in the immediate environment. Zebrafish respond to a broad range of chemical cues detected by the olfactory bulb. Olfaction is particularly important for reproduction in zebrafish. Female zebrafish must come in contact with male gonadal pheromones in order to ovulate. Meanwhile, male zebrafish must come in contact with female pheromones in order to initiate spawning behavior.

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic

  • Cermakian, N., P. Sassone-Corsi. 2002. Environmental stimulus perception and control of circadian clocks. Current Opinion in Neurobiology, 12 (4): 359-365.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Breed all year round (Ref. 58931). From Johnson (1932), 'a female never extrudes eggs during active courtship until the genital organ comes in contact with that of the male, whereupon a small stream of eggs is ejected' (Ref. 205). Violent dashing and chasing characterise courtship finally culminating in eggs being shed a few at a time, settling freely without adhering to the bottom surface (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Immediately after hatching, all zebrafish develop into females. Once they become five to seven weeks old, gonadal differentiation begin to occur, Males take approximately 3 months to fully develop their testes. Sex determination is not fully understood; however, evidence suggests that food supply and growth rates play a key role in sex determination as slow-growing individuals become males and fast-growing individuals become females.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, most zebrafish live to be one year old. In captivity, zebrafish have a mean lifespan of 42 months. The maximum age observed in captivity was 66 months. Captive zebrafish develop spinal curvature after their second year, which is not observed in natural populations.

Range lifespan

Status: captivity:
66 (high) months.

Average lifespan

Status: wild:
1 years.

Average lifespan

Status: captivity:
42 months.

  • Gerhard, G., E. Kauffman, X. Wang, R. Stewart, J. Moore, C. Kasales, E. Demidenko, K. Cheng. 2002. Life spans and senescent phenotypes of zebrafish (Danio rerio). Experimental Gerontology, 37: 1055-1068.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.5 years (captivity) Observations: Outbred zebrafish have a mean lifespan of 3.5 years and can live up to 5.5 years. They exhibit a gradual ageing process. A spinal curvature was reported to be a common age-related phenotype (Gerhard et al. 2002). The zebrafish heart appears to have a robust capacity for regeneration based on the proliferation of cardiomyocytes which can avoid scar formation and allow cardiac regeneration (Poss et al. 2002).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Zebrafish are promiscuous and breed seasonally during monsoon season. Mating behavior is also heavily influenced by photoperiod, as spawning begins immediately at first light during breeding season and continues for about an hour. In order to initiate courtship about 3 to 7 males chase females and try to lead female towards a spawning site by nudging her and/or swimming around her in a tight circle or figure eight. Spawning sites consists of bare substrate that tends to be well vegetated. In captivity, gravel spawning sites are preferred to silt spawning sites. In the wild, zebrafish breed in silt-bottomed habitats. When a breeding pair reaches the spawning site, the male aligns his genital pore with the female's and begins to quiver, which causes the female to release her eggs and the male to release his sperm. The female releases 5 to 20 eggs at a time. This cycle repeats for about an hour. While the presence of female pheromones is required for initiation of courtship behavior in the male, male gonadal pheromones are required by the female for ovulation to occur. There is limited evidence for male-male competition and female mate preference.

Mating System: polygynandrous (promiscuous)

Zebrafish breed seasonally during the monsoons, which occur from April to August. Spawning has also been recorded outside wet season, suggesting that breeding may be seasonal as a result of food availability. They tend to breed in silt-bottomed and well vegetated pools. Zebrafish lay non-adhesive eggs without preparing a nest, and are considered to be group spawners and egg scatterers. Although time to hatching depends on water temperature, most eggs hatch between 48 and 72 hours after fertilization. Chorion thickness and embryo activity also impact incubation time. Zebrafish are approximately 3 mm upon hatching and are immediately independent. They are able to swim, feed, and exhibit active avoidance behaviors within 72 hours of fertilization.

Breeding interval: Zebrafish spawn every 1 to 6 days during spawning season, which occurs once yearly..

Breeding season: Zebrafish spawn during monsoon season, from April to August

Range number of offspring: 1 to 700 .

Average number of offspring: 185.

Range time to hatching: 48 to 72 hours.

Average time to independence: 0 minutes.

Key Reproductive Features: iteroparous ; seasonal breeding ; sequential hermaphrodite (Protogynous ); sexual ; induced ovulation ; fertilization (External ); broadcast (group) spawning; oviparous

Adult zebrafish provide no parental care to young. Zebrafish are independent immediately upon hatching.

Parental Investment: no parental involvement

  • Engeszer, R., L. Patterson, A. Rao, D. Parichy. 2007. Zebrafish in the Wild: A Review of Natural History and New Notes from the Field. Zebrafish, 4: 21-40.
  • Spence, R., G. Gerlach, C. Lawrence, C. Smith. 2008. The behaviour and ecology of the zebrafish, Danio rerio. Biological Reviews, 83: 13-34.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Danio rerio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCAACTAATCATAAAGACATTGGCACCCTGTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGGACCGCATTAAGCCTCTTAATCCGAGCTGAACTTAGCCAACCAGGAGCACTTCTTGGTGAT---GATCAAATCTATAATGTTATTGTTACTGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATACCCATTCTTATTGGGGGATTTGGAAACTGACTTGTGCCACTAATGATTGGGGCCCCCGATATGGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTCTTCCACCCTCATTTCTTCTTCTATTAGCTTCTTCTGGAGTTGAAGCAGGAGCTGGAACAGGATGAACAGTTTATCCACCTCTTGCAGGCAACCTTGCCCATGCAGGAGCATCTGTTGATCTAACAATTTTTTCACTACACTTAGCAGGTGTTTCATCTATTCTTGGAGCAATTAATTTTATTACTACTACAATTAACATGAAGCCACCAACTATCTCTCAGTATCAAACTCCATTATTTGTATGAGCTGTCTTAGTTACAGCTGTACTACTTCTTTTATCTTTACCAGTGTTAGCTGCCGGAATTACAATACTTCTTACAGACCGAAATCTTAACACAACGTTCTTTGACCCGGCAGGAGGGGGAGATCCAATTCTTTATCAACACTTATTTTGATTCTTTGGCCACCCAGAAGTCTACATTCTTATTTTACCAGGATTCGGCATTATCTCCCATGTTGTAGCATACTACGCAGGGAAAAAAGAACCATTCGGGTATATAGGAATAGTATGAGCTATAATGGCTATTGGTCTCTTAGGTTTTATTGTATGAGCCCATCACATATTCACTGTAGGAATGGATGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Danio rerio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Vishwanath, W.

Reviewer/s
Barbhuiya, A.H., Juffe Bignoli, D., Rema Devi, K.R., Dahanukar, N. & Chaudhry, S.

Contributor/s
Molur, S.

Justification

Danio rerio is very widely distributed species with a few populations threatened from overexploitation for ornamental fisheries. Otherwise, the species is not threatened in its entire range and with the recommendation of continuing monitoring of population trends, it is assessed as Least Concern presently.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zebrafish have a broad geographic range and are locally abundant. They breed easily in their native habitat and in 2007, increasing catch rates suggested increasing abundance. Other than potential over exploitation for the aquaria trade, there are no known threats to the long-term persistence of this species. Zebrafish are classified as a species of least concern on the IUCN's Red List of Threatened Species.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

It is difficult to assess the population of the species. It is not common in the natural water bodies. It breeds easily in nature. Aquarists have also artificially bred the fish successfuly. In Nepal the catch per unit effort (CPUE) of this species is up to 1.88 %. In Arunachal Pradesh the catch rate is 1.9 % (Tamang et al. 2007).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

Being a popular aquarium fish, it might suffer from over exploitation resulting in fluctuation of individuals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Although it has been reported from Namdapha National Park, Arunachal Pradesh, it is also distributed in many unprotected areas. Thus, clearly there is a need for improved habitat protection at sites where this species is known to occur. Further survey work is needed to confirm whether or not this species is experiencing a widespread decline, or is undergoing extreme population fluctuations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: highly commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Danio rerio on humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In 1981, George Streisinger and his colleagues began to use zebrafish as a model organism for research. Since then, they have become a popular model organism for biomedical research. Zebrafish primarily have been used to study vertebrate development, evolution, genetics, and disease. Zebrafish are popular as pets and genetically modified, glow-in-the-dark zebrafish have been developed for the aquaria trade as well.

Zebrafish have many attributes that make it a popular model organism for biomedical research. They are small, have a short generation time, and are easy to raise in captivity. Additionally, in comparison to other vertebrates, zebrafish produce a large number of eggs per mating event. Zebrafish undergo external fertilization which allows all stages of development to be easily observed and manipulated. Zebrafish embryos are transparent, making them particularly useful for developmental and embryological research.

Positive Impacts: pet trade ; research and education

  • Briggs, J. 2002. The zebrafish: a new model organism for integrative physiology. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology, 282 (1): R3-R9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Aquarium fish. Used in carcinogenesis testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Zebrafish

The zebrafish, Danio rerio, is a tropical freshwater fish belonging to the minnow family (Cyprinidae) of order Cypriniformes.[1] It is a popular aquarium fish, frequently sold under the trade name zebra danio,[2] and is an important vertebrate model organism in scientific research. It is particularly notable for its regenerative abilities,[3] and has been modified by researchers to produce several transgenic strains.[4][5][6]

Taxonomy [edit]

The zebrafish is a derived member of the genus Danio, of the family Cyprinidae. It has a sister-group relationship with Danio kyathit.[7] Zebrafish are also closely related to the genus Devario, as demonstrated by a phylogenetic tree of close species.[8] The zebrafish was referred to in literature as Brachydanio rerio for many years until its reassignment to the genus Danio.[9]

Distribution [edit]

The zebrafish is native to the streams of the southeastern Himalayan region,[7] and is found in parts of India, Pakistan, Bangladesh, Nepal, and Burma.[10] The species arose in the Ganges region in eastern India, and commonly inhabits streams, canals, ditches, ponds, and slow-moving or stagnant water bodies, including rice fields.[11] Zebrafish have been introduced to parts of the United States, presumably by deliberate release or by escape from fish farms.[10]

Description [edit]

The zebrafish is named for the five uniform, pigmented, horizontal, blue stripes on the side of the body, which are reminiscent of a zebra's stripes, and which extend to the end of the caudal fin. Its shape is fusiform and laterally compressed, with its mouth directed upwards. The male is torpedo-shaped, with gold stripes between the blue stripes; the female has a larger, whitish belly and silver stripes instead of gold. Adult females will exhibit a small genital papilla in front of the anal fin origin. The zebrafish can grow to 6.4 cm (2.5 in) in length, although it seldom grows larger than 4 cm (1.6 in) in captivity. Its lifespan in captivity is around two to three years, although in ideal conditions, this may be extended to five years.[11]

Reproduction [edit]

A juvenile zebrafish.

The approximate generation time for Danio rerio is three to four months. A male must be present for ovulation and spawning to occur. Females are able to spawn at intervals of two to three days, laying hundreds of eggs in each clutch. Upon release, embryonic development begins; absent sperm, growth stops after the first few cell divisions. Fertilized eggs almost immediately become transparent, a characteristic that makes D. rerio a convenient research model species.[11] Development progresses rapidly – precursors to all major organs appear within 36 hours of fertilization, and hatching takes place 12–36 hours later, depending on the embryo's internal conditions and the external temperature, which is ideally 28.5 °C (83.3 °F). Swimming and feeding behavior begin about 36 hours later. The sex of juveniles cannot be distinguished except by dissection, and sex determinants are not clearly understood.

To encourage the fish to spawn, some researchers use a fish tank with a sliding bottom insert, which reduces the depth of the pool. The technique is most effective in the early morning, given that ovulation and spawning are enhanced by light. Researchers have been able to collect 10,000 embryos in 10 minutes using this method.[12] Male zebrafish are furthermore known to respond to more pronounced markings on females, i.e., "good stripes", but in a group, males will mate with whichever females they can find. What attracts females is not currently understood. The presence of plants, even plastic plants, also apparently encourages spawning.[12]

Feeding [edit]

Zebrafish are omnivorous, primarily eating zooplankton, insects, insect larvae, and phytoplankton, although they can eat a variety of other foods, such as worms and small crustaceans, if their preferred food sources are not readily available.[11] Most zebrafish accept common food flakes and tubifex worms in the aquarium.

Aquarium care [edit]

Zebrafish are hardy fish and considered good for beginner aquarists. Their enduring popularity can be attributed to their playful disposition,[13] as well as their rapid breeding, aesthetics, cheap price, and broad availability. They also do well in schools or shoals of six or more, and interact well with other fish species in the aquarium. However, they are susceptible to Oodinium or velvet disease, microsporidia (Pseudoloma neurophilia), and Mycobacterium species. Given the opportunity, adults eat hatchlings, which may be protected by separating the two groups with a net, breeding box or separate tank.

Strains [edit]

In late 2003, transgenic zebrafish that express green, red, and yellow fluorescent proteins became commercially available in the United States. The fluorescent strains are tradenamed GloFish; other cultivated varieties include 'golden', 'sandy', 'longfin' and 'leopard'.

The leopard danio, previously known as Danio frankei, is a spotted colour morph of the zebrafish which arose due to a pigment mutation.[14] Xanthistic forms of both the zebra and leopard pattern, along with long-finned subspecies, have been obtained via selective breeding programs for the aquarium trade.[15]

Wild-type strains [edit]

The Zebra Fish Information Network (ZFIN) provides up-to-date information about current known wild-type (WT) strains of D. rerio, some of which are listed below.[16]

  • AB (AB)
  • AB/C32 (AB/C32)
  • AB/TL (AB/TL)
  • AB/Tuebingen (AB/TU)
  • C32 (C32)
  • Cologne (KOLN)
  • Darjeeling (DAR)
  • Ekkwill (EKW)
  • HK/AB (HK/AB)
  • HK/Sing (HK/SING)
  • Hong Kong (HK)
  • India (IND)
  • Indonesia (INDO)
  • Nadia (NA)
  • RIKEN WT (RW)
  • Singapore (SING)
  • SJA (SJA)
  • SJD (SJD)
  • SJD/C32 (SJD/C32)
  • Tuebingen (TU)
  • Tupfel long fin (TL)
  • Tupfel long fin nacre (TLN)
  • WIK (WIK)
  • WIK/AB (WIK/AB)

Hybrids [edit]

Hybrids between different Danio species may be fertile: for example, between D. rerio and D. nigrofasciatus.[8]

In scientific research [edit]

Zebrafish chromatophores, shown here mediating background adaptation, are widely studied by scientists.
A zebrafish pigment mutant (bottom) produced by insertional mutagenesis.[8] A wild-type embryo (top) is shown for comparison. The mutant lacks black pigment in its melanocytes because it is unable to synthesize melanin properly.

D. rerio is a common and useful model organism for studies of vertebrate development and gene function.[7] Its importance has been consolidated by successful large-scale forward genetic screens (commonly referred to as the Tübingen/Boston screens). The fish has a dedicated online database of genetic, genomic, and developmental information, the Zebrafish Information Network (ZFIN). D. rerio is also one of the few fish species to have been sent into space.

Research with D. rerio has yielded advances in the fields of developmental biology, oncology,[17] toxicology,[18] reproductive studies, teratology, genetics, neurobiology, environmental sciences, stem cell and regenerative medicine,[19] and evolutionary theory.[8]

Model characteristics [edit]

As a model biological system, the zebrafish possesses numerous advantages for scientists. Its genome has been fully sequenced, and it has well-understood, easily observable and testable developmental behaviors. Its embryonic development is very rapid, and its embryos are relatively large, robust, and transparent, and able to develop outside their mother.[20] Furthermore, well-characterized mutant strains are readily available.

Other advantages include the species' nearly constant size during early development, which enables simple staining techniques to be used, and the fact that its two-celled embryo can be fused into a single cell to create a homozygous embryo. The zebrafish is also demonstrably similar to mammalian models and humans in toxicity testing, and exhibits a diurnal sleep cycle with similarities to mammalian sleep behavior.[21]

Regeneration [edit]

Zebrafish have the ability to regenerate their fins, skin, heart and, in larval stages, brain.[22] Zebrafish heart muscle regeneration does not make use of stem cells; instead, mature heart muscle cells regress to a stem cell-like state and redifferentiate.[22] In 2011, the British Heart Foundation ran an advertising campaign publicising their intention to study the applicability of this ability to humans, by raising £50 million in research funding.[23][24]

Zebrafish have also been found to regenerate photoreceptor cells and retinal neurons following injury, which has been shown to be mediated by the dedifferentiation and proliferation of Müller glia.[25] Researchers frequently amputate the dorsal and ventral tail fins and analyze their regrowth to test for mutations. It has been found that histone demethylation occurs at the site of the amputation, switching the zebrafish's cells to an "active", regenerative, stem cell-like state.[26] In 2012, Australian scientists published a study revealing that zebrafish use a specialised protein, known as fibroblast growth factor, to ensure their spinal cords heal without glial scarring after injury.[3]

Another focus of zebrafish research is to understand how a gene called Hedgehog, a biological signal that underlies a number of human cancers, controls cell growth. In probing disorders of the nervous system, including neurodegenerative diseases, movement disorders, psychiatric disorders and deafness, researchers are using the zebrafish to understand how the genetic defects underlying these conditions cause functional abnormalities in the human brain, spinal cord and sensory organs. Researchers have also studied the zebrafish to gain new insights into the complexities of human musculoskeletal diseases, such as muscular dystrophy.[27]

Genetics [edit]

Gene expression [edit]

Due to their short lifecycles and relatively large clutch sizes, zebrafish are a useful model for genetic studies. A common reverse genetics technique is to reduce gene expression or modify splicing using Morpholino antisense technology. Morpholino oligonucleotides (MO) are stable, synthetic macromolecules that contain the same bases as DNA or RNA; by binding to complementary RNA sequences, they reduce the expression of specific genes. MO can be injected into one cell of an embryo after the 32-cell stage, reducing gene expression in only cells descended from that cell. However, cells in the early embryo (less than 32 cells) are interpermeable to large molecules,[28][29] allowing diffusion between cells. A known problem with gene knockdowns is that, because the genome underwent a duplication after the divergence of ray-finned fishes and lobe-finned fishes, it is not always easy to silence the activity one of the two gene paralogs reliably due to complementation by the other paralog.

Despite the complications of the zebrafish genome, a number of commercially available global platforms exist for analysis of both gene expression by microarrays and promoter regulation using ChIP-on-chip.

Genome sequencing [edit]

The Wellcome Trust Sanger Institute started the zebrafish genome sequencing project in 2001, and the full genome sequence of the Tuebingen reference strain is publicly available at the National Center for Biotechnology Information (NCBI)'s Zebrafish Genome Page. The zebrafish reference genome sequence is annotated as part of the Ensembl project, and is maintained by the Genome Reference Consortium.[30]

In 2009, researchers at the Institute of Genomics and Integrative Biology in Delhi announced the sequencing of the genome of a wild zebrafish strain, containing 1.7 billion genetic letters.[31][32] The genome of the wild zebrafish was sequenced at 39-fold coverage. Comparative analysis with the zebrafish reference genome revealed over 5 million single nucleotide variations and over 1.6 million insertion deletion variations.

The zebrafish reference genome sequence was published in 2013.[33]

Mitochondrial DNA [edit]

In October 2001, researchers from the University of Oklahoma published D. rerio's complete mitochondrial DNA sequence.[34] Its length is 16,596 base pairs. This is within 100 base pairs of other related species of fish, and it is notably only 18 pairs longer than the goldfish (Carassius auratus) and 21 longer than the carp (Cyprinus carpio). Its gene order and content are identical to the common vertebrate form of mitochondrial DNA. It contains 13 protein-coding genes and a noncoding control region containing the origin of replication for the heavy strand. In between a grouping of five tRNA genes, a sequence resembling vertebrate origin of light strand replication is found. It is difficult to draw evolutionary conclusions because it is difficult to determine whether base pair changes have adaptive significance via comparisons with other vertebrates nucleotide sequences.

Pigmentation genes [edit]

In December 2005, a study of the golden strain identified the gene responsible for its unusual pigmentation as SLC24A5, a solute carrier that appeared to be required for melanin production, and confirmed its function with a Morpholino knockdown. The orthologous gene was then characterized in humans and a one base pair difference was found to strongly segregate fair-skinned Europeans and dark-skinned Africans.[35]

Transgenesis [edit]

Transgenesis is a popular approach to study the function of genes in zebrafish. Construction of transgenic zebrafish is rather easy by a method using the Tol2 transposon system.[36]

Transparent adult bodies [edit]

In 2008, researchers at Boston Children's Hospital developed a new strain of zebrafish, named Casper, whose adult bodies had transparent skin.[5] This allows for detailed visualization of cellular activity, circulation, metastasis and many other phenomena. Because many gene functions are shared between fish and humans, the Casper strain is expected to yield insights into human diseases such as leukemia and other cancers.[5] In January 2013, Japanese scientists genetically modified a transparent zebrafish specimen to produce a visible glow during periods of intense brain activity, allowing the fish's "thoughts" to be recorded as specific regions of its brain lit up in response to external stimuli.[6]

Use in environmental monitoring [edit]

In January 2007, Chinese researchers at Fudan University genetically modified zebrafish to detect oestrogen pollution in lakes and rivers, which is linked to male infertility.[4]

In medical research [edit]

Cancer [edit]

Zebrafish have been used to make several transgenic models of cancer, including melanoma, leukemia, pancreatic cancer and hepatocellular carcinoma.

Melanoma [edit]

Zebrafish expressing mutated forms of either the BRAF or NRAS oncogenes develop melanoma when placed onto a p53 deficient background. Histologically, these tumors strongly resemble the human disease, are fully transplantable, and exhibit large-scale genomic alterations. The BRAF melanoma model was utilized as a platform for two screens published in March 2011 in the journal Nature. In one study, by Ceol, Houvras and Zon, the model was used as a tool to understand the functional importance of genes known to be amplified and overexpressed in human melanoma.[37] One gene, SETDB1, markedly accelerated tumor formation in the zebrafish system, demonstrating its importance as a new melanoma oncogene. This was particularly significant because SETDB1 is known to be involved in the epigenetic regulation that is increasingly appreciated to be central to tumor cell biology. In another study, by White and Zon, an effort was made to therapeutically target the genetic program present in the tumor's origin neural crest cell using a chemical screening approach.[38] This revealed that an inhibition of the DHODH protein (by a small molecule called leflunomide) prevented development of the neural crest stem cells which ultimately give rise to melanoma via interference with the process of transcriptional elongation. Because this approach would aim to target the "identity" of the melanoma cell rather than a single genetic mutation, leflunomide may have utility in treating human melanoma.[39]

Cardiovascular disease [edit]

In cardiovascular research, the zebrafish has been used to model blood clotting, blood vessel development, heart failure, and congenital heart and kidney disease.[40]

Immune system [edit]

In programmes of research into acute inflammation, a major underpinning process in many diseases, researchers have established a zebrafish model of inflammation, and its resolution. This approach allows detailed study of the genetic controls of inflammation and the possibility of identifying potential new drugs.[41]

Repairing retinal damage [edit]

Another notable characteristic of the zebrafish is that it possesses four types of cone cell, with ultraviolet-sensitive cells supplementing the red, green and blue cone cell subtypes found in humans. Zebrafish can thus observe a very wide spectrum of colours. The species is also studied to better understand the development of the retina; in particular, how the cone cells of the retina become arranged into the so-called 'cone mosaic'. Zebrafish, in addition to certain other teleost fish, are particularly noted for having extreme precision of cone cell arrangement.[42]

This study of the zebrafish's retinal characteristics has also extrapolated into medical enquiry. In 2007, researchers at University College London grew a type of zebrafish adult stem cell found in the eyes of fish and mammals that develops into neurons in the retina. These could be injected into the eye to treat diseases that damage retinal neurons—nearly every disease of the eye, including macular degeneration, glaucoma, and diabetes-related blindness. The researchers studied Müller glial cells in the eyes of humans aged from 18 months to 91 years, and were able to develop them into all types of retinal neurons. They were also able to grow them easily in the lab. The stem cells successfully migrated into diseased rats' retinas, and took on the characteristics of the surrounding neurons. The team is working to develop the same approach in humans.[43]

Drug discovery [edit]

As demonstrated through ongoing research programmes, the zebrafish model enables researchers not only to identify genes that might underlie human disease, but also to develop novel therapeutic agents in drug discovery programmes.[44] Zebrafish embryos have proven to be a rapid, cost-efficient, and reliable teratology assay model.[45]

See also [edit]

References [edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2007). "Danio rerio" in FishBase. March 2007 version.
  2. ^ "Zebra Danio". Aquatics To Your Door. Retrieved 10 April 2013. 
  3. ^ a b Goldshmit, Yona; Sztal, Tamar E.; Jusuf, Patricia R.; Hall, Thomas E.; Nguyen-Chi, Mai; Currie, Peter D. (2012). "Fgf-Dependent Glial Cell Bridges Facilitate Spinal Cord Regeneration in Zebrafish". The Journal of Neuroscience 32 (22): 7477–92. doi:10.1523/JNEUROSCI.0758-12.2012. PMID 22649227. Lay summarySci-News.com (1 June 2012). 
  4. ^ a b Song Houyan and Zhong Tao, professors at Fudan's molecular medicine lab, spent three years cloning estrogen-sensitive genes and injecting them into the fertile eggs of zebrafish. The modified fish turn green if they are placed into water that is polluted by estrogen. "Fudan scientists turn fish into estrogen alerts". Xinhua. 12 January 2007. Retrieved 15 November 2012.
  5. ^ a b c White, Richard Mark; Sessa, Anna; Burke, Christopher; Bowman, Teresa; Leblanc, Jocelyn; Ceol, Craig; Bourque, Caitlin; Dovey, Michael et al. (2008). "Transparent Adult Zebrafish as a Tool for in Vivo Transplantation Analysis". Cell Stem Cell 2 (2): 183–9. doi:10.1016/j.stem.2007.11.002. PMC 2292119. PMID 18371439. Lay summaryLiveScience (6 February 2008). 
  6. ^ a b "Researchers Capture A Zebrafish's Thought Process On Video". Popular Science. 31 January 2013. Retrieved 4 February 2013. 
  7. ^ a b c Mayden, Richard L.; Tang, Kevin L.; Conway, Kevin W.; Freyhof, Jörg; Chamberlain, Sarah; Haskins, Miranda; Schneider, Leah; Sudkamp, Mitchell et al. (2007). "Phylogenetic relationships of Danio within the order Cypriniformes: A framework for comparative and evolutionary studies of a model species". Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 308B (5): 642–54. doi:10.1002/jez.b.21175. PMID 17554749. 
  8. ^ a b c d Parichy, D M (2006). "Evolution of danio pigment pattern development". Heredity 97 (3): 200–10. doi:10.1038/sj.hdy.6800867. PMID 16835593. 
  9. ^ "The zebrafish book". ZFIN. Retrieved 15 July 2012. 
  10. ^ a b "zebra danio (Brachydanio rerio)". Nonindigenous Aquatic Species. United States Geological Survey. 2003-07-22. Retrieved 2012-07-22. 
  11. ^ a b c d Spence, Rowena; Gerlach, Gabriele; Lawrence, Christian; Smith, Carl (2007). "The behaviour and ecology of the zebrafish, Danio rerio". Biological Reviews 83 (1): 13–34. doi:10.1111/j.1469-185X.2007.00030.x. PMID 18093234. 
  12. ^ a b Dockser, Amy (January 13, 2012). "Birds Do It, Bees Do It, Even Zebrafish Do It—Just Too Little". The Wall Street Journal. Retrieved February 11, 2012. 
  13. ^ Gerhard, Glenn S.; Cheng, Keith C. (2002). "A call to fins! Zebrafish as a gerontological model". Aging Cell 1 (2): 104–11. doi:10.1046/j.1474-9728.2002.00012.x. PMID 12882339. 
  14. ^ Watanabe, Masakatsu; Iwashita, Motoko; Ishii, Masaru; Kurachi, Yoshihisa; Kawakami, Atsushi; Kondo, Shigeru; Okada, Norihiro (2006). "Spot pattern of leopard Danio is caused by mutation in the zebrafish connexin41.8 gene". EMBO reports 7 (9): 893–7. doi:10.1038/sj.embor.7400757. PMC 1559663. PMID 16845369. 
  15. ^ Mills, Dick (1993). Eyewitness Hnbk Aquarium Fish. Harper Collins. ISBN 0-7322-5012-9. [page needed]
  16. ^ "ZFIN". ZFIN. Retrieved 2012-07-22. 
  17. ^ Xiang, Jing; Yang, Hongbo; Che, Chao; Zou, Haixia; Yang, Hanshuo; Wei, Yuquan; Quan, Junmin; Zhang, Hui et al. (2009). "Identifying Tumor Cell Growth Inhibitors by Combinatorial Chemistry and Zebrafish Assays". In Isalan, Mark. PLoS ONE 4 (2): e4361. doi:10.1371/journal.pone.0004361. PMC 2633036. PMID 19194508. 
  18. ^ Hill, A. J.; Teraoka, H; Heideman, W; Peterson, RE (2005). "Zebrafish as a Model Vertebrate for Investigating Chemical Toxicity". Toxicological Sciences 86 (1): 6–19. doi:10.1093/toxsci/kfi110. PMID 15703261. 
  19. ^ Major, Robert J.; Poss, Kenneth D. (2007). "Zebrafish heart regeneration as a model for cardiac tissue repair". Drug Discovery Today: Disease Models 4 (4): 219–25. doi:10.1016/j.ddmod.2007.09.002. PMC 2597874. PMID 19081827. 
  20. ^ Dahm, Ralf (2006). "The Zebrafish Exposed". American Scientist 94 (5): 446–53. 
  21. ^ Jones, Rachel (2007). "Let Sleeping Zebrafish Lie: A New Model for Sleep Studies". PLoS Biology 5 (10): e281. doi:10.1371/journal.pbio.0050281. PMC 2020498. PMID 20076649. 
  22. ^ a b Wade, Nicholas (March 24, 2010). "Research Offers Clue Into How Hearts Can Regenerate in Some Species". The New York Times. 
  23. ^ "Mending Broken Hearts (2011) British Heart Foundation TV ad". British Heart Foundation via YouTube. January 31, 2011. Retrieved November 15, 2012. 
  24. ^ "British Heart Foundation – The science behind the appeal". Bhf.org.uk. February 16, 2007. Retrieved November 15, 2012. 
  25. ^ Bernardos, Rebecca L.; Barthel, Linda K.; Meyers, Jason R.; Raymond, Pamela A. (2007). "Late-Stage Neuronal Progenitors in the Retina Are Radial Muller Glia That Function as Retinal Stem Cells". Journal of Neuroscience 27 (26): 7028–40. doi:10.1523/JNEUROSCI.1624-07.2007. PMID 17596452. 
  26. ^ Stewart, Scott; Tsun, Zhi-Yang; Izpisua Belmonte, Juan Carlos (2009). "A histone demethylase is necessary for regeneration in zebrafish". Proceedings of the National Academy of Sciences 106 (47): 19889–94. doi:10.1073/pnas.0904132106. JSTOR 25593294. PMC 2785262. PMID 19897725. Lay summaryScience Daily (2 November 2009). 
  27. ^ "The zebrafish as a model for muscular dystrophy and congenital myopathy". Human Molecular Genetics. 8 August 2003. Retrieved 6 March 2013. 
  28. ^ Kimmel, Charles B.; Law, Robert D. (1985). "Cell lineage of zebrafish blastomeres". Developmental Biology 108 (1): 78–85. doi:10.1016/0012-1606(85)90010-7. PMID 3972182. 
  29. ^ Kimmel, Charles B.; Law, Robert D. (1985). "Cell lineage of zebrafish blastomeres". Developmental Biology 108 (1): 94–101. doi:10.1016/0012-1606(85)90012-0. PMID 3972184. 
  30. ^ "Genome Reference Consortium". GRC. Retrieved 23 October 2012. 
  31. ^ "Decoding the Genome Mystery". Indian Express. July 5, 2009. Retrieved February 5, 2013.
  32. ^ FishMap Zv8. Institute of Genomics and Integrative Biology (IGIB). Retrieved June 7, 2012.
  33. ^ The zebrafish reference genome sequence and its relationship to the human genome Nature (2013) doi:10.1038/nature12111
  34. ^ Broughton, Richard E.; Milam, Jami E.; Roe, Bruce A. (2001). "The Complete Sequence of the Zebrafish (Danio rerio) Mitochondrial Genome and Evolutionary Patterns in Vertebrate Mitochondrial DNA". Genome Research 11 (11): 1958–67. doi:10.1101/gr.156801 (inactive November 15, 2012). PMC 311132. PMID 11691861. 
  35. ^ Lamason, R. L.; Mohideen, MA; Mest, JR; Wong, AC; Norton, HL; Aros, MC; Jurynec, MJ; Mao, X et al. (2005). "SLC24A5, a Putative Cation Exchanger, Affects Pigmentation in Zebrafish and Humans". Science 310 (5755): 1782–6. doi:10.1126/science.1116238. PMID 16357253. 
  36. ^ Kawakami, Koichi; Takeda, Hisashi; Kawakami, Noriko; Kobayashi, Makoto; Matsuda, Naoto; Mishina, Masayoshi (2004). "A Transposon-Mediated Gene Trap Approach Identifies Developmentally Regulated Genes in Zebrafish". Developmental Cell 7 (1): 133–44. doi:10.1016/j.devcel.2004.06.005. PMID 15239961. 
  37. ^ Ceol, Craig J.; Houvras, Yariv; Jane-Valbuena, Judit; Bilodeau, Steve; Orlando, David A.; Battisti, Valentine; Fritsch, Lauriane; Lin, William M. et al. (2011). "The histone methyltransferase SETDB1 is recurrently amplified in melanoma and accelerates its onset". Nature 471 (7339): 513–7. doi:10.1038/nature09806. PMC 3348545. PMID 21430779. 
  38. ^ White, Richard Mark; Cech, Jennifer; Ratanasirintrawoot, Sutheera; Lin, Charles Y.; Rahl, Peter B.; Burke, Christopher J.; Langdon, Erin; Tomlinson, Matthew L. et al. (2011). "DHODH modulates transcriptional elongation in the neural crest and melanoma". Nature 471 (7339): 518–22. doi:10.1038/nature09882. PMID 21430780. 
  39. ^ "Arthritis Drug Could Help Beat Melanoma Skin Cancer, Study Finds". Science Daily. 24 March 2011. Retrieved 15 November 2012. 
  40. ^ "Kidney development and disease in the zebrafish". NCBI. 2005. Retrieved 26 November 2012. 
  41. ^ "Investigating inflammatory disease using zebrafish". Fish For Science. Retrieved 15 November 2012. 
  42. ^ Allison, W. Ted; Barthel, Linda K.; Skebo, Kristina M.; Takechi, Masaki; Kawamura, Shoji; Raymond, Pamela A. (2010). "Ontogeny of cone photoreceptor mosaics in zebrafish". The Journal of Comparative Neurology 518 (20): 4182–95. doi:10.1002/cne.22447. PMC 3376642. PMID 20878782. 
  43. ^ Lawrence, Jean M.; Singhal, Shweta; Bhatia, Bhairavi; Keegan, David J.; Reh, Thomas A.; Luthert, Philip J.; Khaw, Peng T.; Limb, Gloria Astrid (2007). "MIO-M1 Cells and Similar Müller Glial Cell Lines Derived from Adult Human Retina Exhibit Neural Stem Cell Characteristics". Stem Cells 25 (8): 2033–43. doi:10.1634/stemcells.2006-0724. PMID 17525239. Lay summaryThe China Post (3 August 2007). 
  44. ^ "Fish for Science". University of Sheffield. 2011. Retrieved March 19, 2011. 
  45. ^ Brannen, Kimberly C.; Panzica-Kelly, Julieta M.; Danberry, Tracy L.; Augustine-Rauch, Karen A. (2010). "Development of a zebrafish embryo teratogenicity assay and quantitative prediction model". Birth Defects Research Part B: Developmental and Reproductive Toxicology 89 (1): 66–77. doi:10.1002/bdrb.20223. PMID 20166227. 

Further reading [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!