Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur in lagoon and seaward reefs with hard substrate; young abundant in tide pools (Ref. 3145, 48637). Benthopelagic (Ref. 58302). Often feeding near freshwater run-offs where certain algae grow on rocks that are grazed (Ref. 48637). Occasionally form schools; feed on filamentous algae in large aggregations. During spawning, clouds of eggs and sperm are preyed upon by eagle rays which are often present during spawning. Form spawning aggregations (Ref. 27825). Size of metamorphosis from post-larva stage to juvenile is 3.2 cm (Ref. 9267). Utilized as a food fish (Ref. 7364). Minimum depth reported taken from Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occur in lagoon and seaward reefs with hard substrate; young abundant in tide pools (Ref. 3145, 48637). Benthopelagic (Ref. 58302). Often feeding near freshwater run-offs where certain algae grow on rocks that are grazed (Ref. 48637). Occasionally form schools; feed on filamentous algae in large aggregations. During spawning, clouds of eggs and sperm are preyed upon by eagle rays which are often present during spawning. Form spawning aggregations (Ref. 27825). Size of metamorphosis from post-larva stage to juvenile is 3.2 cm (Ref. 9267). Utilized as a food fish (Ref. 7364). Minimum depth reported taken from Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Acanthurus triostegus is widely distributed throughout the Indo-Pacific, including Yemen, but it is not found elsewhere in the Arabian Peninsula. In the eastern Pacific it occurs from the lower Gulf of California, El Salvador to Ecuador and all the oceanic islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Convict tangs are found throughout the Indo-Pacific region, as well as the eastern Pacific Ocean from the lower Gulf of California to Panama. They are also known as convict surgeonfish or Manini.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Panama, north to southern Japan and Ogasawara Islands, south to Lord Howe Island, New Caledonia, Kermadec Islands, Rapa and Ducie (Pitcairn Group)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: throughout the region except for the seas around the Arabian Peninsula. Eastern Pacific: lower Gulf of California to Panama, including the Revillagigedo, Cocos, Clipperton, and Galapagos islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Convict tangs have a pale body color varying from white/greenish-white to gray or even yellow. This background is overlaid with distinct, vertical black stripes, including one going through each eye. They are highly laterally compressed and have small scales, gill rakers, dorsal spines and anal spines. Their average length is 17.0 cm, with a maximum length of 27.0 cm.

Range length: 27.0 (high) cm.

Average length: 17.0 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 9; Dorsal soft rays (total): 22 - 26; Analspines: 3; Analsoft rays: 19 - 22
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 270 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

27.0 cm TL (male/unsexed; (Ref. 3145))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in lagoon and seaward reefs with hard substrate to a depth of at least 90 m and feeds on a wide variety of filamentous algae. Occasionally forms schools; feeds in large aggregations, thus overwhelming territorial herbivores. During spawning, clouds of eggs and sperm of this species are preyed upon by eagle rays which are often present during spawning. Size of metamorphosis from postlarva stage to juvenile is 3.2 cm (Ref. 9267). Commonly ciguatoxic in Tuvalu (Ref. 9513).
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body olivaceous gray, with 4 vertical stripes (1 stripe on head across the yellow eye; 1 on caudal peduncle); shading to white ventrally, often with a sharp line of demarcation. Sharp, forward-pointing, erectile spine on each side of caudal peduncle which folds down into a groove. Scales minute. Teeth with denticulations on sides and top. Gill rakers 18-22 in anterior row, 19-24 in posterior row.Description: Characterized further by having small caudal spine; greatest depth of body 1.8-1.9 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This reef-associated species occurs in lagoons and seaward reefs with hard substrate. It is usually seen in reef crests in shallow exposed reef fronts (J.H. Choat pers. comm. 2010). The young are abundant in tide pools (Randall 1986, Kuiter and Tonozuka 2001) In the Gulf of Chiriqui, Panama, this species can be found over zones of madreporic branching corals, in sheltered areas (Dominici-Arosemena and Wolff 2006). In Hawaii, this species occurs in bays, harbours, and exposed reef areas. It abounds in tide pools and shallow water, yet is also known in depths of at least 100 ft (Randall 1961b). It is often observed feeding near freshwater run-offs where certain algae grow on rocks (Kuiter and Tonozuka 2001). Adults are often observed in large feeding aggregations, it may also be seen as solitary or in small groups. Large aggregations may be dense and cover areas more than 50 ft in diameter (Randall 1961b). It feeds on algal turfs (Choat et al. 2004). It is classified as a grazer (Green and Bellwood 2009).
It rarely achieves sizes above 20 cm (TL).

Reproduction

The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010). This species spawns year-round in equatorial waters, but seasonally in Hawaii, coinciding with the colder part of the year (February-March) (Randall 1961b). It recruits year-round in Guam (J. McIlwain unpub. data).

It was observed to form spawning aggregations on the Great Barrier Reef (Randall 1961a, 1961b; Johannes 1981; Robertson 1983). In Palau it spawns from May-August after the new moon (Randall 1961b). At Aldabra Atoll it spawns from November-December (Robertson 1983). During midday to dusk fish migrate in dense streams to aggregation sites, reaching tens of thousands to spawn (Randall 1961a, 1961b; Robertson 1983; Randall et al. 1990). Males displayed a spawning colour phase. Spawning takes place in pulses by sub-groups of 10-20 fish (Randall 1961a, 1961b; Robertson 1983). Pair spawning has also been observed in this species. A. triostegus aggregations are resident spawning aggregations (Domeier and Colin 1997). Its size during metamorphosis, from the post-larval stage to juvenile, is 3.2 cm (Krupp 1995). The eggs and larvae are pelagic. The smallest running ripe female found on Oahu was 10.1 cm (SL); the smallest male 9.7 cm (SL) (Randall 1961b).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 205 specimens in 1 taxon.
Water temperature and chemistry ranges based on 178 samples.

Environmental ranges
  Depth range (m): 0.15 - 150
  Temperature range (°C): 24.488 - 29.336
  Nitrate (umol/L): 0.009 - 2.863
  Salinity (PPS): 32.938 - 36.148
  Oxygen (ml/l): 4.444 - 4.879
  Phosphate (umol/l): 0.083 - 0.543
  Silicate (umol/l): 0.897 - 6.035

Graphical representation

Depth range (m): 0.15 - 150

Temperature range (°C): 24.488 - 29.336

Nitrate (umol/L): 0.009 - 2.863

Salinity (PPS): 32.938 - 36.148

Oxygen (ml/l): 4.444 - 4.879

Phosphate (umol/l): 0.083 - 0.543

Silicate (umol/l): 0.897 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Convict tangs are surgeonfish that prefer to occupy coral reefs, but are also found in tidepools and other nearshore habitats such as shallow, low current beach communities. They are tropical reef fish whose latitudinal range is 26ºN to 36ºS with a longitudinal range from 25ºE to 85ºW. Convict tangs are mainly found in temperatures ranging from 24-26ºC and at depths of 0-90 m.

Range depth: 90 to 0 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: pelagic ; benthic ; reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 90m.
Recorded at 90 meters.

Habitat: reef-associated. Convict surgeon.  (Linnaeus, 1758)  Attains 27 cm. Light greenish-grey with 4 vertical black bars on body; a further slightly angled black bar on head which passes through the eye and a small vertical black bar on caudal peduncle. The underside is white and the fins yellowish green. Some specimens have small black spots on the fins and body. This is one of the most common of the Acanthuridae family and is generally confined to shallow inshore reefs and rock pools as the growth of its algal food is dependant on light penetration. It is also often found in harbours where sheltered wharfs and jetties provide ideal surfaces for the growth of vegetable matter. Unlike the painted surgeon, this species is gregarious, and shoals ranging in size from a few to thousands of fish may be seen feeding on a variety of red, green and threadlike seaweeds, which, being of low energy content, are grazed continuously throughout the day. In contrast to other vegetarian fishes, the convict surgeon digests its food completely. Sexual maturity takes place at 10 cm. and breeding is known to coincide with periods of full moon during late winter and spring. Spawning occurs in shoals and the transparent, pelagic juveniles are distributed by the ocean currents. Indo-Pacific (except Red Sea and Persian Gulf); also in eastern Pacific south to the Bashee River with postlarvae drifting as far as Algoa Bay. Juveniles are common in tidal pools. When large schools form to feed on benthic algae they overwhelm the territorial herbivorous fishes such as the damselfishes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 90 m (Ref. 9710), usually 0 - 90 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 205 specimens in 1 taxon.
Water temperature and chemistry ranges based on 178 samples.

Environmental ranges
  Depth range (m): 0.15 - 150
  Temperature range (°C): 24.488 - 29.336
  Nitrate (umol/L): 0.009 - 2.863
  Salinity (PPS): 32.938 - 36.148
  Oxygen (ml/l): 4.444 - 4.879
  Phosphate (umol/l): 0.083 - 0.543
  Silicate (umol/l): 0.897 - 6.035

Graphical representation

Depth range (m): 0.15 - 150

Temperature range (°C): 24.488 - 29.336

Nitrate (umol/L): 0.009 - 2.863

Salinity (PPS): 32.938 - 36.148

Oxygen (ml/l): 4.444 - 4.879

Phosphate (umol/l): 0.083 - 0.543

Silicate (umol/l): 0.897 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Convict tangs are herbivores, grazing on algae found on rocks and corals. Adaptations to their algivorous diet include mouths that are slightly downwardly-directed and flexible, comb-like teeth.

Plant Foods: algae

Primary Diet: herbivore (Algivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occur in lagoon and seaward reefs with hard substrate; young abundant in tide pools (Ref. 3145, 48637). Often feeding near freshwater run-offs where certain algae grow on rocks that are grazed (Ref. 48637). Feed on filamentous algae in large aggregations. Roving herbivore (Ref. 57615). Also Ref. 58534, 58652.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

The grazing of convict tangs on algae helps keep algal populations in check. Convict tangs also host symbiotic unicellular organisms in their gut, including one of the largest known bacterial species (Epulopiscium fishelsoni). Convict tangs are host to endoparasitic nematodes and trematodes, as well as at least one ectoparasitic copepod species.

Mutualist Species:

  • Epulopiscium fishelsoni (Class Clostridia, Kingdom Bacteria)

Commensal/Parasitic Species:

  • Spirocamallanus colei (Class Secernentea, Phylum Nematoda)
  • Hysterolecitha acanthuri (Class Trematoda, Phylum Platyhelminthes)
  • Caligus flexispina (Subclass Copepoda, Subphylum Crustacea)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Convict tangs have been observed exhibiting tonic immobility, which may be a response to the presence of a predator. As with other surgeonfishes, they have sharp blades on either side of the tail; however, these blades are poorly developed in convict tangs and not typically used for defense. Instead, this species relies on traveling in large schools, as well as its disruptive color pattern, for protection. Although undoubtedly not a complete list of predators, convict tangs are known to be preyed upon by argus grouper, ash-colored conger eel, honeycomb grouper, cornet fish, and black-tail snapper. Eagle rays are also known to feed on convict tang gametes during spawning.

Known Predators:

  • Argus grouper (Cephalopholis argus)
  • Ash-colored conger eel (Conger cinereus)
  • Honeycomb grouper (Epinephelus quoyanus)
  • Cornet fish (Fistularia commersonii)
  • Black-tail snapper (Lutjanus fulvus)
  • Eagle ray (Myliobatidae sp.)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Hysterolecitha Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Convict tangs are able to perceive their environments through a number of sensory pathways, including sight, olfaction, sound and vibrations (detected by their lateral lines). Information regarding which of these senses are important in intra- and interspecific communication is currently unavailable.

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

  • Bond, C. 1996. Biology of Fishes. Stamford, CT: Brooks/Cole.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Convict tang eggs hatch into clear pelagic larvae. In Hawaiian populations it takes about 2.5 months for these planktonic larvae to develop into juveniles in a reef or tidepool; larvae typically adapt to their benthic surroundings within 24 hours. Initially, juveniles lack the vertical bars present in adults.

Development - Life Cycle: indeterminate growth

  • Nakamura, Y., T. Shibuno, D. Lecchini, T. Kawamura, Y. Watanabe. 2009. Spatial variability in habitat associations of pre- and post-settlement stages of coral reef fishes at Ishigaki Island, Japan. Marine Biology, 156/11: 2413-2419. Accessed November 20, 2011 at http://www.springerlink.com/content/mt21663471706w38/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Form spawning aggregations (Ref. 27825).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Convict tangs have a typical lifespan of 5-7 years in captivity. Their average lifespan in the wild is currently unknown.

Range lifespan

Status: captivity:
5 to 7 years.

Typical lifespan

Status: captivity:
5 to 7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Convict tangs spawn in resident spawning aggregations. Spawning groups can be as large as tens of thousands of fish with subgroups of 10-20 fish, although pair spawning has also been observed. Research in Hawaii showed that individuals may migrate up to 2 km to reach spawning sites on the seaward side of a reef or in channels connecting lagoons to open ocean.

Mating System: polygynandrous (promiscuous)

Convict tang populations near the equator can spawn at any time during the year, while populations elsewhere may only spawn seasonally (in Hawaii spawning occurs around full moons in February and March).

Breeding interval: Convict tangs breed annually.

Breeding season: Spawning can occur year round in equatorial habitats and seasonally in other parts of the range.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Convict tangs are broadcast spawners and provide no parental investment to offspring.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus triostegus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCTTGAGCCGGAATAGTAGGAACAGCACTAAGCCTCCTGATCCGAGCAGAACTAAGTCAACCAGGCGCCCTCCTAGGGGATGATCAAATTTATAATGTAATTGTCACGGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAATTGACTAATCCCTCTAATGATTGGAGCTCCCGATATGGCATTCCCACGAATGAATAATATGAGCTTTTGACTTCTACCACCATCTTTCCTACTCCTACTTGCATCCTCCGCAGTAGAGTCTGGTGCCGGAACTGGATGAACGGTTTACCCCCCTTTAGCCGGTAATCTGGCGCACGCAGGAGCATCTGTAGATCTTACTATTTTCTCCCTCCATCTTGCAGGAATTTCTTCAATTCTTGGGGCTATTAATTTTATTACAACAATCATTAATATGAAACCCCCTGCTATTTCTCAGTACCAAACACCCCTATTCGTATGAGCAGTACTAATTACTGCCGTCCTACTCCTTCTCTCACTCCCTGTTCTTGCCGCTGGCATTACAATGTTACTTACAGATCGAAACCTAAACACCACCTTCTTCGATCCGGCAGGCGGAGGGGATCCTATCCTATACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus triostegus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 63
Specimens with Barcodes: 145
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
McIlwain, J., Choat, J.H., Abesamis, R., Clements, K.D., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
McClenachan, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus triostegus is widespread throughout the Indo-Pacific region. There is a strong geographical pattern in genetic structure throughout the Pacific, but this does not warrant species recognition. It is very abundant in some parts of its range. It is a targeted food and recreational species. There are no indications of global population declines through harvesting. It is found in a number marine protected areas in parts of its range. It is therefore listed as Least Concern. We recommend monitoring of the harvest levels and population status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Convict tangs currently have no special conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Acanthurus triostegus was recorded as the most abundant species of surgeonfish in the Hawaiian Islands (Randall 1961b). It is an abundant inshore species (Randall 2001b). Marine recreational catch surveys administered by the Hawaii Marine Recreational Fishing Survey in 2006 recorded 432,182 individuals (Friedlander et al. 2006). It is the 3rd most commercially landed acanthurid in Hawaii, with an average of 5,800 kg from 1997-2005 (Hawaii Division of Aquatic Resources unpub. data).

It was recorded as occasional in Raja Ampat, Indonesia, where it is usually found in shallow, wave affected areas (Allen 2003b). It is locally abundant in the Philippines (B. Stockwell pers. comm. 2010). In Calamianes Islands, El Nido and San Vicente, Palawan, it is moderately common in shallow, wave affected areas near shore (Werner and Allen 2000, Palawan Council for Sustainable Development unpub. data). In Moorea, French Polynesia,the Acanthuridae family was dominant on the barrier reef (2.30 ind. m-2) and on the outer slope, (1.61 spec. m-2). On the barrier reef, this species accounted for 37% of the total density (Moussa 2009).

In Guam, A. triostegus accounts for 6% of acanthurid landings and less than 1% in Saipan (Guam Division of Aquatic and Wildlife Resources unpub. data). After a hurricane in Reunion Is. in January 1989, the density of Acunthurus triostegus, decreased six months after the hurricane, and later increased. Abundance estimates record 19 ind/200 m2 (LeTourner et al. 1993).

In Kenya, landings during 1978-2001 for families that are less important in commercial catches (e.g., scarinae and Acanthuridae) showed rising catches (1978-1984) followed by a general decline during the 1990s (Kaunda-Arara et al. 2003).

Visual census surveys in the Iboih coast, Weh Island, Indonesia recorded fish densities of 18 individuals/750 m2 at Pantai Sirkui, 11 individuals/750 m2 at Teupin Layeu and 12 individuals/750 m2 at Teluk Pelabuhan (Faculty of Mathematics and Natural Science 2007). It was recorded as occasional in terms of relative abundance in Milne Bay Province, Papua New Guinea, usually in shallow wave-affected areas (Allen 2003).

This species is very abundant on offshore islands other than the Galapagos (where it is uncommon), and common in clear water environments along the tropical eastern Pacific continental coast and Gorgona Island, Colombia. According to Robertson and Allen (1996), this fish was frequent enough to have a resident population in Clipperton Atoll. In Cabo Pulmo, Gulf of California, this species was considered scarce (Villarreal-Cavazos et al. 2000).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized fishing for artisanal and recreational fisheries is a threat in some areas.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There have been reports of humans suffering from ciguatera poisoning after consuming convict tangs, although the species is generally considered safe to eat.

Negative Impacts: injures humans (poisonous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Convict tangs are part of the human diet in tropical regions. They are also sold in the aquarium trade.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acanthurus triostegus

The manini (Acanthurus triostegus) is a small surgeonfish in family Acanthuridae of the order Perciformes. It is about 13 centimetres (5.1 in) long. It is whitish-yellow with zebra-like black stripes on its sides. It is also known as Convict Tang.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!