Skip to content

Aplocheilus panchax — Details

Blue Panchax learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Occurs in lowland wetlands to estuaries and peats (Ref. 57235). Found in ponds and ditches (Ref. 4835) canals (Ref. 1479), reservoirs and mangrove creeks (Ref. 13061). Prefers clear water in areas with dense growth of rooted or floating macrophytes (Ref. 12693). Sometimes occurring in hypersaline waters. Feeds mainly on insects (Ref. 13061). Utilized for mosquito control. Is difficult to maintain in aquarium (Ref. 27139). Rarely caught by commercial fishermen and not seen in markets (Ref. 12693). Popular aquarium fish (Ref. 57235).

Huber, J.H. 1996 Killi-Data 1996. Updated checklist of taxonomic names, collecting localities and bibliographic references of oviparous Cyprinodont fishes (Atherinomorpha, Pisces). Société Française d'Ichtyologie, Muséum National d'Histoire Naturelle, Paris, France, 399 p. (Ref. 27139) http://www.fishbase.org/references/FBRefSummary.php?id=27139&speccode=12252

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Range Description

Learn more about this article

Reported from Pakistan (Lower Indus plain and adjoining hilly areas), India (mainly northeastern and northern), and from Bangladesh, Myanmar,Sri Lanka, and Nepal. The taxonomic status of records from Viet Nam, Cambodia and the Indo-Malayasian archipelago must be verified. It been introduced in some areas for mosquito control (R. Britz pers. comm.).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Asia: Pakistan, India, Bangladesh, Myanmar and the Indo-Malaysian archipelago. Reported from Nepal (Ref. 9496) Cambodia, Viet Nam (Ref. 27139) and Sri Lanka (Ref. 6028).

Huber, J.H. 1996 Killi-Data 1996. Updated checklist of taxonomic names, collecting localities and bibliographic references of oviparous Cyprinodont fishes (Atherinomorpha, Pisces). Société Française d'Ichtyologie, Muséum National d'Histoire Naturelle, Paris, France, 399 p. (Ref. 27139) http://www.fishbase.org/references/FBRefSummary.php?id=27139&speccode=12252

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Physical Description

Size

Learn more about this article

Maximum size: 90 mm ---

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Max. size

Learn more about this article

9.0 cm TL (male/unsexed; (Ref. 41236))

Menon, A.G.K. 1999 Check list - fresh water fishes of India. Rec. Zool. Surv. India, Misc. Publ., Occas. Pap. No. 175, 366 p. (Ref. 41236) http://www.fishbase.org/references/FBRefSummary.php?id=41236&speccode=64642

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology

It inhabits clear, shallow and brackish waters at low attitudes.

Systems

Freshwater

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1.2 - 2
  Temperature range (°C): 28.885 - 28.885
  Nitrate (umol/L): 0.075 - 0.075
  Salinity (PPS): 32.200 - 32.200
  Oxygen (ml/l): 4.427 - 4.427
  Phosphate (umol/l): 0.339 - 0.339
  Silicate (umol/l): 4.465 - 4.465

Graphical representation

Depth range (m): 1.2 - 2

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Environment

Learn more about this article

benthopelagic; non-migratory; freshwater; brackish; pH range: 6.0 - 8.0; dH range: 5 - 12

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

A perennial breeder (Ref. 27139), both in fresh and brackish waters, particularly from November to March (Ref. 7020).

Riehl, R. and H.A. Baensch 1991 Aquarien Atlas. Band. 1. Melle: Mergus, Verlag für Natur- und Heimtierkunde, Germany. 992 p. (Ref. 1672) http://www.fishbase.org/references/FBRefSummary.php?id=1672&speccode=5234

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aplocheilus panchax

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GBGC6827-09|NC_011176|Aplocheilus panchax| ACACGTTGATTCTTCTCAACCAACCATAAAGATATCGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTTGGAACGGCCTTA---AGCCTACTTATTCGAGCTGAACTAAGTCAGCCGGGATCCCTTCTGGGCGAC---GACCAAATTTATAATGTAATCGTAACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATACCAGTAATGATTGGAGGCTTTGGGAACTGATTAGTTCCTCTCATG---ATCGGCGCCCCAGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTACTTCCTCCCTCCTTCTTACTTCTATTAGCTTCTTCTGGTGTAGAAGCAGGAGCTGGTACAGGCTGAACCGTTTACCCCCCTCTCGCAGGAAATCTCGCTCATGCAGGACCTTCCGTCGATTTA---ACCATTTTCTCACTTCATTTAGCGGGGGTGTCCTCTATTCTGGGGGCTATCAATTTTATTACTACCATTATTAATATAAAACCTCCCGCCATCTCACAATACCAAACCCCTCTCTTTGTATGAGCAGTAATAATTACCGCCGTACTTCTTTTACTTTCCCTTCCTGTATTAGCTGCC---GGTATTACAATACTTTTAACAGACCGAAACCTAAATACCTCTTTCTTCGACCCGGCAGGAGGAGGTGACCCCATTCTTTACCAACACCTTTTCTGATTTTTCGGCCATCCAGAGGTTTATATCCTTATTTTACCAGGATTCGGCATAATCTCCCATATTGTCGCTTACTACTCCGGTAAAAAA---GAACCCTTCGGATACATGGGTATAGTCTGGGCTATAATAGCAATTGGCCTACTGGGCTTTATTGTATGAGCCCATCACATATTCACCGTCGGTATAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Aplocheilus panchax

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 9
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article

Red List Category

LC

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2010

Assessor/s

Chaudhry, S.

Reviewer/s

Jha, B.R., Allen, D., Datta, N.C., Britz, R. & Dey, S.C.

Contributor/s

Molur, S.

Justification

A widespread species with no known major widespread threats, Aplocheillus panchax is assessed as Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Trends

Population

Learn more about this article

Population

No information available, but wide ranging.

Population Trend

Unknown

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Threats

Threats

Learn more about this article

Major Threats

There are no known threats to this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Least Concern (LC)

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

Conservation not required; research into the species taxonomy is required, as it may be a species complex.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: minor commercial; aquarium: commercial

Mills, D. and G. Vevers 1989 The Tetra encyclopedia of freshwater tropical aquarium fishes. Tetra Press, New Jersey. 208 p. (Ref. 7020) http://www.fishbase.org/references/FBRefSummary.php?id=7020&speccode=5247

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Whitespot

Learn more about this article

For other uses, see White spot (disambiguation).

This article does not cite any references or sources. Please help improve this article by adding citations to reliable sources. Unsourced material may be challenged and removed. (December 2009)

The whitespot or blue panchax, Aplocheilus panchax, is a common freshwater fish found in a large variety of habitats due to its high adaptability. A native fish of Southeast Asia, it has even been discovered in two hot springs in Singapore.

Identified by a white-coloured spot on its head which gave it its name, the 8 cm long species tends to keep to the surface of the water, and is useful in controlling the mosquito population by feeding on its larvae.

This Cyprinodontiformes article is a stub. You can help Wikipedia by expanding it.

This Singapore-related article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!