Overview

Comprehensive Description

Biology

A little-known lanternshark, mainly from depths below 900 m. Ovoviviparous (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Southeast Atlantic and western Indian Ocean: Namibia, South Africa (Northern Cape near Hondeklip Bay, Western Cape from Saldanha Bay to Cape Agulhas, Eastern Cape from Plettenberg Bay to Algoa Bay, and northern kwaZulu-Natal) (Compagno in prep).

Eastern Indian Ocean and southwest Pacific: southern Australia (from Perth to in Western Australia to Victoria and Tasmania), seamounts south of Australia including the Cascade Plateau and South Tasman Rise and from New South Wales, north to Taree (Compagno in prep). Yano (1997) recorded E. unicolor from the ridges to the north (Three Kings Ridge and Lord Howe Rise) of New Zealand waters, but further taxonomic study is required to determine whether Northern and Southern Hemisphere populations are con-specific (M. Francis pers. comm. 2007).

Northwest Pacific: Japan (southeastern Honshu) (Compagno in prep).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wesstern Pacific and southeastern Indian Ocean off Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Japan (Ref. 247) and New Zealand (Ref. 13669).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 640 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

64.0 cm TL (male/unsexed; (Ref. 13669)); 75 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Continental and insular slopes, often at the bottom and sometimes well off it. Found at depths of 402–1,380 m (Compagno et al. 2005). Maximum total length 79 cm total length (TL); size at birth about 17 cm (TL); immature males 23–51 cm (TL), adolescent males 45–51 cm (TL), adult males 48–68 cm (TL); immature females 26–56 cm (TL), adolescent females 37–67 cm (TL), adult females 53–63 cm (TL) (Compagno in prep.).

This species may have similar life-history characteristics to E. baxteri. A recent study by Irvine et al. (2006) on the age and growth of E. baxteri provided unvalidated age estimates for this species. These suggest that females reach maturity between 11.5 and 30 years of age, and males at 10.5–20 years. The lower and upper estimates are based on external growth bands, and internal growth bands, respectively. Although there is a large discrepancy between the preliminary upper and lower estimates, they both suggest that E. baxteri is a long-lived and late maturing species. Etmopterus unicolor may share similar life-history characteristics, making it susceptible to depletion by over-fishing.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1206.5 - 1206.5
  Temperature range (°C): 3.887 - 3.887
  Nitrate (umol/L): 31.854 - 31.854
  Salinity (PPS): 34.492 - 34.492
  Oxygen (ml/l): 3.801 - 3.801
  Phosphate (umol/l): 2.280 - 2.280
  Silicate (umol/l): 67.081 - 67.081
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Etmopterus unicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Etmopterus cf. unicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATCTTTGGTGCATGAGCAGGAATAGTGGGCACAGCCTTAAGCTTGCTTATTCGAGCTGAGCTAAGTCAGCCTGGAACTCTTCTGGGGGACGATCAGATCTATAATGTTATTGTAACTGCCCATGCATTTGTAATAATCTTTTTCATAGTTATACCGGTAATAATCGGTGGGTTTGGAAATTGATTAGTGCCTTTAATAATCGGTGCACCGGATATAGCTTTTCCACGAATAAATAATATAAGCTTCTGACTACTACCACCAGCACTACTTCTGCTTTTAGCCTCTGCCGGTGTTGAAGCAGGAGCCGGAACTGGCTGAACAGTTTACCCCCCCCTTGCAGGAAATATAGCTCATGCCGGGGCATCCGTAGACTTGGCCATTTTCTCGCTTCACTTAGCTGGCATCTCCTCAATTTTAGCCTCCGTTAATTTTATTACAACCATTATTAATATAAAACCCCCAGCTATTTCTCAATACCAAACACCACTATTTGTTTGATCAATCCTTGTAACTACTGTTCTTCTCCTCCTTGCCCTCCCCGTACTTGCAGCTGCAATTACGATACTACTTACTGACCGTAATTTAAACACAACATTTTTTGACCCCTCCGGCGGGGGAGACCCCATTTTATATCAACACTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Etmopterus cf. unicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Etmopterus unicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATCTTTGGTGCATGAGCAGGAATAGTGGGCACAGCCTTAAGCTTGCTTATTCGAGCTGAACTGAGTCAGCCTGGAACTCTTCTGGGAGACGATCAGATCTATAATGTTATTGTAACTGCCCATGCATTTGTAATAATCTTTTTCATAGTTATACCGGTAATAATCGGTGGCTTTGGAAATTGATTAGTGCCTTTAATAATTGGTGCACCGGATATAGCTTTTCCACGAATAAATAATATAAGCTTCTGACTGCTACCACCAGCACTACTTCTGCTTTTAGCCTCTGCCGGTGTTGAAGCAGGAGCCGGAACTGGCTGAACAGTTTACCCCCCTCTTGCAGGAAATATAGCCCATGCCGGGGCATCCGTAGACTTGGCCATTTTCTCGCTTCACTTAGCTGGTATCTCCTCAATTTTAGCCTCCGTTAATTTTATTACAACCATTATTAATATAAAACCCCCAGCTATCTCTCAATATCAAACACCACTATTTGTTTGATCAATCCTTGTAACTACTGTCCTTCTCCTCCTTGCCCTCCCCGTACTTGCAGCTGCAATTACGATACTTCTTACTGACCGTAATTTAAACACAACATTTTTTGACCCTTCCGGTGGGGGAGACCCCATTTTATATCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
McCormack, C. & Valenti, S.V.

Reviewer/s
Ebert, D.A., Stevens, J. & Francis, M. (Shark Red List Authority)

Contributor/s

Justification
The Bristled Lanternshark (Etmopterus unicolor) is a deepwater lantern shark found on continental and insular slopes, often at the bottom and sometimes well off it, at depths of 402–1,380 m. Known from the western and southern coasts of South Africa, southern Australia, Namibia and Japan. This species probably has limiting life-history characteristics, like other deepwater squalid sharks (preliminary age data show that similar species mature at 11.5–30 years), making it vulnerable to population depletion. It is taken as bycatch of various fisheries throughout its range. It was taken in large quantities off Australia and discarded, but the survival of discards was probably very low. At present there is insufficient information to assess this species beyond Data Deficient; however efforts should be made to quantify bycatch levels to enable reassessment in the near future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Common off the west and south coasts of South Africa, off southern Australia. In these areas this species is caught with the larger E. baxteri (Compagno in prep). Both species were caught together in 29% of 65 short (half-hour) experimental trawls by research vessels on the slopes at 383–1,300 m off the west and southeast coasts of South Africa. In some instances in sufficient numbers to suggest, but not prove, mixed schools (Compagno in prep). It is known only from a few records on the Three Kings Ridge and Lord Howe Rise, north of New Zealand and has not been recorded within the New Zealand EEZ (Yano 1997, M. Francis pers. comm. 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Probably an incidental bycatch of trawl fisheries for Deepwater Hake (Merluccius paradoxus) off the west coast of South Africa, and it used to be caught in deepwater trawl fisheries for Orange Roughy (Hoplostethus atlanticus, Trachichthyidae) off Australia, although these have now been much reduced through quotas and closed areas. It is also caught in the epipelagic zone, at up to 120 m depth, by Japanese longliners in the open ocean near Australia (Compagno in prep.). This species is sometimes caught in large quantities off southern Australia and discarded. However, discarded catch would probably have very low survival rates (J.D. Stevens pers. comm. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific measures are in place.

Recommended: Bycatch in fisheries should be quantified and population trends monitored. Information is also required on the life-history characteristics.

Restrictions on trawling below 700 m in southern Australia, and basket quotas on deep-water dogfish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brown lanternshark

The Brown lanternshark or Bristled lanternshark (Etmopterus unicolor) is a little-known species of deep-sea dogfish shark in the family Etmopteridae. It is found off Japan and New Zealand, and possibly also South Africa and Australia, typically deeper than 300 m (980 ft). This species can be distinguished from other lanternsharks by its coloration, which is a uniform dark gray or brown without the ventral surface being much darker and clearly delineated from the rest of the body. The brown lanternshark feeds on small bony fishes, cephalopods, and crustaceans. Reproduction is ovoviviparous, with females giving birth to 9–18 young. An unusually high proportion of individuals in Suruga Bay are hermaphrodites, with both male and female characteristics.

Taxonomy[edit]

The brown lanternshark was first described by Robert Engelhardt as Spinax unicolor in 1912, in the scientific journal Zoologischer Anzeiger. The type specimen was a 55 cm (22 in) long female from Sagami Bay, Japan.[1] In 1965, Tokiharu Abe redescribed this species and moved it to the genus Etmopterus.[2] The Australian Etmopterus "sp. B" (known as the "bristled lanternshark") are now tentatively believed to be the same as this species.[3] It is grouped with the velvet belly lantern shark (E. spinax), Caribbean lanternshark (E. hillianus), fringefin lanternshark (E. schultzi), broadbanded lanternshark (E. gracilispinis), combtooth lanternshark (E. decacuspidatus), and dwarf lanternshark (E. perryi) in having irregularly arranged, needle-shaped dermal denticles.[4]

Distribution and habitat[edit]

Confirmed specimens of the brown lanternshark have been captured from off southern Honshu, Japan, and around New Zealand. If E. compagnoi and E. sp. B are also considered, then the known range of this species is extended to off South Africa (and possibly southern Namibia) and southern Australia. The brown lanternshark inhabits continental shelves and seamounts at a depth of 402–1,380 m (1,319–4,528 ft), though is most common below 900 m (3,000 ft). It is generally found deeper than other lanternsharks that share its range, and may have midwater habits.[3][5]

Description[edit]

The brown lanternshark has a robust, almost cylindrical body with a wide, flattened head. There are around 28 tooth rows in the upper jaw and 34 tooth rows in the lower jaw. The upper teeth have a pointed central cusp flanked by fewer than three pairs of lateral cusplets, while the bottom teeth are large and tipped with a strongly angled triangular cusp.[2] The five pairs of gill slits are relatively large, about half as long as the eyes. The first dorsal fin is low with a minute leading spine; the second dorsal fin is twice as high as the first with a much larger spine. The caudal peduncle is short, leading to a long caudal fin with the upper lobe much larger than the lower.[1][3]

The dermal denticles of this shark are tiny and densely placed with no regular pattern; each denticle has a four-cornered base and rises to a narrow, slightly curved point. The denticles of females are firmly attached, while those of males are easily removed. The coloration is a plain dark gray or brown, slightly darker below and lighter on the dorsal fin margins. Unlike other lanternsharks, there is a not a sharp contrast between the dorsal and ventral colors. There is a horizontal black line on the base of the tail, and another fainter black mark over the pelvic fins.[2][3] The maximum reported length is 64 cm (25 in) for males and 75 cm (30 in) for females.[6]

Biology and ecology[edit]

The most important prey of the brown lanternshark are bony fishes (mainly lanternfishes), followed by cephalopods (mainly the squid Watasenia scintillans), and finally crustaceans (mainly prawns such as Acanthephyra).[7] A known parasite of this shark is a species of copepod in the genus Lerneopoda.[2]

Like other lanternsharks, the brown lanternshark is ovoviviparous, meaning the young hatch inside the mother's uterus and are sustained by a yolk sac.[6] The litter size is 9–18.[8] Newborns measure 17 cm (6.7 in) in length.[3] Males reach sexual maturity at a length of 46 cm (18 in), and females at a length of 50 cm (20 in). A study of brown lanternsharks in Suruga Bay by Yano and Tanaka (1989) found a 23% prevalence of hermaphroditism within the population.[8] Of the 16 hermaphrodites examined, 15 were functional females (and some were pregnant) that also possessed well-developed claspers (male intromittent organs), while one was a functional male with ovarian tissue in the left testis. The reason why so many sharks in Suruga Bay are hermaphroditic is unclear, but has been speculated to relate to pollution.[8]

Human interactions[edit]

The brown lanternshark is harmless and of no significance to fisheries. Its conservation status has not been evaluated by the International Union for Conservation of Nature.[6]

References[edit]

  1. ^ a b Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. p. 86. ISBN 92-5-101384-5. 
  2. ^ a b c d Abe, T. (February 15, 1965). "Notes on Etmopterus unicolor". Japanese Journal of Ichthyology 12 (3/6): 64–69. 
  3. ^ a b c d e Compagno, L.J.V., Dando, M. and Fowler, S. (2005). Sharks of the World. Princeton University Press. pp. 108–109. ISBN 978-0-691-12072-0. 
  4. ^ Springer, S. and G.H. Burgess (August 5, 1985). "Two New Dwarf Dogsharks (Etmopterus, Squalidae), Found off the Caribbean Coast of Colombia". Copeia 1985 (3): 584–591. doi:10.2307/1444748. JSTOR 1444748. 
  5. ^ Yano, K. (1996). "First record of the brown lanternshark, Etmopterus unicolor, from the waters around New Zealand, and comparison with the southern lanternshark, E. granulosus". Ichthyological Research 44 (1): 61–72. doi:10.1007/BF02672759. 
  6. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2009). "Etmopterus unicolor" in FishBase. July 2009 version.
  7. ^ Baba, O., Taniuchi, T. and Nose, Y. (1987). "Depth Distribution and Food Habits of Three Species of Small Squaloid Sharks off Choshi". Nippon Suisan Gakkaishi 53 (3): 417–424. doi:10.2331/suisan.53.417. 
  8. ^ a b c Yano, K. and Tanaka, S. (September 1989). "Hermaphroditism in the lantern shark Etmopterus unicolor (Squalidae, chondrichthyes)". Ichthyological Research 36 (3): 338–345. doi:10.1007/BF02905618. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!