Overview

Comprehensive Description

Description

  Common names: shark (English), tiburón (Espanol)
 
Carcharhinus signatus (Poey, 1868)



Night shark     Fr - Requin nuit     Es - Tiburón de noche


Body fusiform and stout; snout long, (1.7-1.9 in the distance between nostrils), narrow, pointed; eyes large, nictitating eyelid present; nasal flap short with narrow base; mouth small; very short labial folds; upper teeth with oblique point, front edge smooth to little serrated, rear edge strongly serrated at base; lower teeth with a narrow upright point; spiracles absent; gill slits short, last two over pectoral fin base; first dorsal low, with long rear tip, front edge weakly convex, rear margin concave, origin over rear of pectoral fin margin; second dorsal very small, elongate rear tip, base over anal fin; pectoral fins long, narrow; low ridge present between dorsal fins; no keel on tail base.


Greyish blue above with scattered black spots, greyish white below; eyes green; inside mouth white.


Size: 280 cm

Coastal and semioceanic

Depth: 0 - 600 m, usually 50-100 m.

Found on both sides of the Atlantic; unconfirmed reports from the coast of Panama in the eastern Pacific.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Coastal and semi-oceanic species found on or along outer continental and insular shelves (Ref. 244). Found to depths of 40 m (Ref. 26938). Forms schools (Ref. 244). Nocturnal (Ref. 5578), and feeding mainly on small bony fishes and squid (Ref. 244). Viviparous (Ref. 50449). Off West Africa, recorded water parameters at 90 to 285 m, where it was caught includes: temperature = 11 to 16°C; salinity = 36 ppt; oxygen = 1.81 ml/l (Ref. 244). Not known to be dangerous to people (Ref. 244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The Night Shark (Carcharhinus signatus) is found in the tropical to warm temperate Atlantic (and possibly in the eastern Pacific), usually near the edge of continental and insular shelves at depths of 100 to 600 meters. In the western Atlantic, it occurs from Delaware to Florida, the Gulf of Mexico, the Bahamas, Cuba, and off southern Brazil and Argentina. (McEachran and Fechhelm 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Historically known in abundance only from the north coast of Cuba, where it was so common in the Gulf Stream that 36 specimens were counted at one time at the shark fishery station at Cojimar, and from the offing of South Carolina (Tee-van et al. 1948). Recorded by name from Georgetown, British Guiana, as well as from Key West and the Dry Tortugas, Florida, but without any supporting evidence as to the identity of the specimens concerned. The fact that only one specimen has been reported from the east coast of the United States, although it is easily recognizable, suggests that it infrequently wanders northward from the tropics (Tee-van et al. 1948, Robins et al. 1986). In more recent times, it has been recorded from Delaware, Bahamas, and southwest Florida to southern Brazil, including the Gulf of Mexico, and west Africa (Castro 1983). .

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Delaware to Florida, Bahamas, and Cuba; southern Brazil, Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Studies on the species have been carried out at several localities along the Brazilian coast during the past five years. Whether or not specimens examined from the different localities belong to the same population or whether there is exchange between the animals off Brazil with those in other parts of its range is unknown. Pregnant females are observed in northeastern Brazil, although full-term embryos and new-born specimens are never caught, perhaps due to size-selectivity of gear used. On the shelf break in the southern region of its distribution (latitude ~34° South) (Hellebrandt and Vooren 2000) the animals are predominantly juveniles, and the area is thought to be an important nursery area.

The night shark makes up 90% of elasmobranchs caught by longline over seamounts off northeastern Brazil (Amorim et al. 1998). About 89% of individuals in landings are below age-at-50%-maturity. Recruitment to the seamount longline fisheries occurs at five years. Demographic analysis carried out using data collected over seamounts off northeastern Brazil indicates declines due to a high fishing mortality rate (F=0.117) and early recruitment causing an annual loss of 4.4% (Santana da Silva 2001). Fishing mortality is double that required to maintain population equilibrium (Z?=0.287). Estimates of total mortality (Z), natural mortality (M), initial natural mortality (Z0) and equilibrium fishing mortality (F?) are 0.355, 0.238, 0.362 and 0.049, respectively. Further, the reproductive net rate (R0) is estimated to be 0.59 and generation time (G) 11.71. Average fecundity is 9.5 embryos and the sex ratio of embryos is 1:1 (Santana da Silva 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, East Pacific + Atlantic (East +/or West), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent, Continent only

Residency: Resident

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Delaware to Florida (USA), Bahamas, and Cuba; southern Brazil, Argentina. Eastern Atlantic: Senegal to Côte d'Ivoire, Ghana to Cameroon, Democratic Republic of the Congo, Angola, off northern Namibia (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern and western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 600 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 280.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

280 cm TL (male/unsexed; (Ref. 244)); max. published weight: 76.7 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Sometimes confused with silky shark, which has a shorter snout, different teeth, and longer pectoral fins.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A slim shark with a very long, pointed snout, large eyes, and small jaws with oblique-cusped serrated upper teeth; dorsal fins low with elongated rear tips; interdorsal ridge present (Ref. 5578). Grey-brown above, white below; no conspicuous fin markings (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Oceanic, entering clear waters along outer edge of reefs (Robins et al. 1986), but also occurring near rocks, pilings, and seawalls closer to shore (Voss et al. 1969). Characterized by large green eyes, indicating that it is a deep-water species; usually found in depths greater than (270-360 m) during the day and about 180 m at night (Castro 1983). Cuban fishermen report that it is caught well offshore only on set lines at depths greater than 150 fathoms, and only at night (hence its local name "Tiburon de Noche") (Tee-van et al. 1948).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found at depths between 0 - 600m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Castro (1983) reports that this species is usually found at depths between 275 and 366 m during the day and <183 m at night. Compagno (in prep b) reports that the species prefers waters 50 to 100 m deep, but that it ranges from the surface to at least 600 m depth. In northeastern Brazil C. signatus is caught in commercial landings on deep (Aracati, Dois Irmaos Fundo, Sirius) and shallow (Pequeno, Leste and Sueste) seamounts at depths of 38 to 370 m on the summits. In these areas mating occurs throughout the austral summer; embryos measuring 10 to 40 cm TL were collected in February, whereas 31 to 37 cm TL embryos were found in June. Parturition occurs during several months in a protracted birthing season. Size-at-birth is estimated to be 66.8 cm TL. The gestation period is assumed to be about one year. Whether or not there is a resting break between two reproductive seasons is unclear. Gravid females have between 4 and 15 pups. Peak gonadosomatic index (GSI) occurs in spring and ovulation occurs shortly after that. Copulation is assumed to occur in summer. Average fecundity is 9.5 embryos and the sex ratio of embryos is 1:1 (Santana da Silva 2001).

As mentioned above, about 89% of individuals in landings in the seamount fishery are below age-at-50%-maturity (eight years for males and 10 years for females). Recruitment to the seamount longline fisheries occurs at five years (157 cm TL for males and 202 cm TL for females). Maximum size in the area is 260 cm TL, and size-at-50%-maturity is 185 cm TL for males and 202 cm TL for females. Maximum age in this area is 17 years (Santana and Lessa 2004).

Age and growth were determined for the northeastern Brazil region from vertebral sections from 317 animals. Von Bertalanffy growth functions showed no significant differences between sexes. Growth parameter estimates were L? = 270 cm TL, k = 0.11 yr?1; t0 = -2.71 yr (Santana and Lessa 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; marine; depth range 0 - 600 m (Ref. 244), usually 50 - 100 m (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 533 specimens in 1 taxon.
Water temperature and chemistry ranges based on 467 samples.

Environmental ranges
  Depth range (m): 26 - 2100
  Temperature range (°C): 3.547 - 24.323
  Nitrate (umol/L): 0.757 - 30.559
  Salinity (PPS): 34.738 - 36.432
  Oxygen (ml/l): 1.065 - 6.105
  Phosphate (umol/l): 0.118 - 2.306
  Silicate (umol/l): 1.328 - 26.312

Graphical representation

Depth range (m): 26 - 2100

Temperature range (°C): 3.547 - 24.323

Nitrate (umol/L): 0.757 - 30.559

Salinity (PPS): 34.738 - 36.432

Oxygen (ml/l): 1.065 - 6.105

Phosphate (umol/l): 0.118 - 2.306

Silicate (umol/l): 1.328 - 26.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 600m.
Recorded at 600 meters.

Habitat: benthopelagic. Atlantic species
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Surface, Near Surface, Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Primarily feeds upon fishes and shrimp.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Exact number of occurrences is unknown but may be moderately large given the wide range of the species in the tropical Atlantic Ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: No reliable estimate can be made of the global abundance. Historically considered very abundant in deep waters off the northern coast of Cuba and the Straits of Florida (Tee-van et al. 1948, Castro 1983), although the species has undoubtedly been affected by heavy fishing in recent years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds mainly on small bony fishes and squid
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Viviparous, placental (Ref. 50449), with 4 to 12 young in a litter (Ref. 244). Size at birth about 60 cm (Ref. 244). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 31.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Development is viviparous; litters usually consist of about 10-18 young (Castro 1983, Branstetter 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus signatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTTGGTGCCTGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGACAACCTGGATCTCTTTTAGGAGATGATCAGATTTATAATGTAATCGTAACCGCTCACGCTTTTGTAATAATCTTTTTTATGGTTATACCAATTATAATTGGTGGTTTCGGAAATTGACTAGTTCCCTTAATAATTGGTGCACCAGACATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTCGCCTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTATCCTCCATTAGCTAGTAACCTAGCACATGCCGGACCATCTGTTGATTTAGCTATTTTTTCCCTTCACTTAGCTGGTGTTTCATCAATTTTAGCTTCAATTAATTTCATCACAACTATTATTAATATAAAACCACCAGCTATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACTACTATTCTCCTTCTCCTTTCACTTCCAGTTCTTGCAGCAGGGATTACAATACTACTTACAGATCGTAACCTTAATACTACATTCTTTGATCCTGCAGGTGGAGGAGATCCAATCCTTTATCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus signatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Apparently widespread distribution in the Atlantic Ocean, although concentrated in tropical seas, particularly around Cuba; unknown number of occurrences and individuals; populations likely have declined due to fishing; characterized by slow growth and low reproductive rate, hence vulnerable to overfishing, which probably is the major threat; no known protected occurrences; habitat degradation in coastal areas may affect nursery grounds for young.

Other Considerations: Misidentifications have made abundance and range records difficult to interpret.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2abd+3bd+4abd

Version
3.1

Year Assessed
2006

Assessor/s
Santana, F.M., Lessa, R. & Carlson, J.

Reviewer/s
Cavanagh, R.D., Kyne, P.M., Walker, T.I., Stevens, J., Dudley, S. & Pollard, D. (Shark Red List Authority)

Contributor/s

Justification
Concern for the status of Carcharhinus signatus off South America arises from uncontrolled fishing effort on the species and from its comparatively low biological productivity. Under intense fishing pressure off parts of Brazil, C. signatus is a target species (for fins and meat) regularly caught in commercial fisheries on seamounts off northeastern Brazil where the species aggregates. The Night Shark is the most important elasmobranch species in the seamount area where it makes up 90% of catches from over shallow banks. Estimates of age composition indicated that 89.2% of individuals were below the age at 50% maturity. Demographic analysis indicates declines due to fishing mortality rate and early recruitment to the fishery. It is likely that there are no significant natural refuges for the species and that there is little or no exchange with other populations of C. signatus. Formerly common in Caribbean fisheries, this species is now apparently rare. Historically, night sharks comprised a significant proportion of the artisanal Cuban shark fishery, making up to 60 to 75% of the catch from 1937 to 1941. However, beginning in the 1970?s with the development of the swordfish fishery, anecdotal evidence has indicated a substantial decline in the abundance of this species. Night sharks comprised 26.1% of the shark catch in the pelagic US longline fishery from 1981 to 1983, but observer data showed this to decline to 0.3% and 3.3% of the shark catch in 1993 and 1994. Further, photographic evidence from marlin tournaments in south Florida in the 1970?s shows that large Night Sharks were caught daily, but today they are rarely captured. However, recent trends in catch rates from the pelagic logbook data indicate that the trend has stabilized since 1992, the Fishery Management Plan of the Atlantic tunas, swordfish and sharks currently lists the Night Shark as a Prohibited Species and recent time/area closures should help to reduce any further increases in bycatch. All this considered, the Night Shark is assessed as Vulnerable globally based on significant population declines throughout its Western Atlantic range due to target and bycatch exploitation by fisheries, which although now managed in US waters, is not the case elsewhere in the region.

There is currently no available information from the Eastern Atlantic distribution of C. signatus off West Africa, and until further research and enquiries in this region, the species cannot be assessed beyond Data Deficient for this part of its range, although coastal fisheries in the region are known to be intense and its apparent disjunct distribution could easily lead to localised depletions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Vulnerable

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Unknown whether extant populations are stable, increasing, or decreasing. However, this species is classified as a large coastal shark by the National Marine Fisheries Service and this category, which includes several species, has been overfished in coastal waters of the United States (Burgess 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Formerly common in Caribbean fisheries, this species is now apparently rare (Compagno et al. 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Primarily threatened by fishing; extremely susceptible to overfishing, due to slow growth and low reproductive rate (Hoenig and Gruber 1987, Branstetter 1990). Present in the Yucatan commercial fishery (Bonfil et al. 1990). Coastal and estuarine areas may be important for young, therefore, habitat degradation from mechanical and water quality impacts may pose a threat (Pratt and Casey 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Carcharhinus signatus is a target species and is regularly caught in commercial landings on deep (Aracati, Dois Irmaos Fundo, Sirius) and shallow (Pequeno, Leste and Sueste) seamounts off northeastern Brazil (Ceara and Rio Grande do Norte), at depths of 38?370 m on the summits. Exploitation started in 1991 for the highly prized fins, the increasing value of shark meat in the local market, and the species? accessibility to fisheries. Carcharhinus signatus is the most abundant elasmobranch species in the seamount fisheries where it makes up 90% of catches in number over shallow banks (CPUE, in number 2.94/100 hooks) but only 15% of catches on the surrounding deep areas (CPUE 0.04/100 hooks) using the traditional Japanese-style multifilament longline (Amorim et al. 1998). Estimates of age composition for the whole sample indicated that 89.2% of individuals were below age-at-50%-maturity (eight years for males and 10 years for females). Recruitment to the fisheries is at five years of age. The population is highly aggregated over the seamounts and shelf break and, thus, highly ?available? to fisheries. It is likely that there are no natural refuges for the species and that there is little or no exchange with other populations of C. signatus. One possible respite for the population is re-targeting away from C. signatus to Swordfish Xiphias gladius and Bigeye Tuna Thunnus obesus.

Historically, Night Sharks comprised a significant proportion of the artisanal Cuban shark fishery, making up to 60?75% of the catch from 1937?1941 (Martinez 1947). However, beginning in the 1970?s with the development of the swordfish fishery, anecdotal evidence has demonstrated a substantial decline in the abundance of this species. Guitart-Manday (1975) documented a decline in the mean weight per unit of effort for night sharks from 53.4 kg in 1971 to 21.1 kg in 1973.

Night sharks comprised 26.1% of the shark catch in the pelagic U.S. longline fishery from 1981-1983 (Berkeley and Campos 1988), but this declined to 0.3% and 3.3% of the shark catch in 1993 and 1994 based on observer data (L. Beerkircher, unpublished data). Further, photographic evidence from marlin tournaments in south Florida in the 1970?s shows that large night sharks were caught daily but today they are rarely captured (J.I. Castro, personal observation). However, recent trends in catch rates from the pelagic logbook data indicate that the trend has stabilized since 1992 (Brown and Cramer 2002). Night sharks are still caught incidentally as bycatch in the US Longline Fishery although the species currently makes up only 2% of the shark catch. Recent time/area closures off the Florida Straits and the Charleston Bump should help to reduce any further increases in bycatch because most night shark catches occur in these areas (L. Beerkircher, NOAA Fisheries, pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vulnerable (VU) (A2abd+3bd+4abd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Biological Research Needs: There is a need to better understand population dynamics and reproduction (Tee-Van et al. 1948).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Comments: No known protected occurrences. Management is problematic because of the difficulty in obtaining accurate landing statistics due to the diffuse nature of fish handling systems; also due to the low priority based upon low values of landings (Hoenig and Gruber 1987). In 1989, the National Marine Fisheries Service judged large coastal sharks (including the night shark) to have been overfished by 2,348 metric tons and in 1990 by 1,431 metric tons. As a result, the National Marine Fisheries Service set annual poundage quotas, called total allowable catches for each of the heavily fished groups. In 1993 the total allowable catch for large coastal sharks was set at 2,436 metric tons plus a 464 metric tons recreational quota. The total allowable catch for large coastal sharks was set to be adjusted annually upward at 80% of the annual surplus production. This strategy was predicted to allow for a population increase leading to a return of the natural Maximum Sustainable Yield by the year 2000 (Burgess 1998). Sport anglers were restricted to two sharks per boat per trip for combined large coastal and pelagic sharks. Sale of recreationally caught sharks was prohibited (Burgess 1998). Finning of sharks by commercial fishereis and recreational anglers was prohibited. In addition a system of data collection and reporting was partially implemented (Burgess 1998). Still this plan has underestimated the recovery of the stocks (Burgess 1998). The total annual take of large coastal sharks was reduced to a total of 2,570 metric tons in 1994 and additional restrictions may be forthcoming (Burgess 1998).

Needs: Protect occurrences such that that the maximum sustainable yield is not exceeded an adequate number of sexually mature individuals is maintained.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Brazil: There are controls on the number of vessels in the fishery and the use of drift nets is prohibited, but there needs to be enforcement of existing laws that ban the transport of shark fins without corresponding carcasses, better monitoring of landings, and declaration of closed fishing areas over some of the seamounts off northeastern Brazil. The Brazilian National Plan of Action for Sharks (NPOA-Sharks) is in urgent need of implementation under the FAO International Plan of Action for the Conservation and Management of Sharks (IPOA-Sharks).

US: In US waters, under the Fishery Management Plan of the Atlantic tunas, swordfish and sharks (NMFS 1999), the Night Shark, Carcharhinus signatus, is currently listed as a Prohibited Species but was originally petitioned and added to the Candidate Species List under the Endangered Species Act in 1997. Recent time/area closures off the Florida Straits and the Charleston Bump should help to reduce any further increases in bycatch (L. Beerkircher, NOAA Fisheries, pers. comm).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Night shark

The night shark (Carcharhinus signatus) is a species of requiem shark, family Carcharhinidae, found in the temperate and tropical waters of the Atlantic Ocean. An inhabitant of the outer continental shelf and upper continental slope, this shark most commonly occurs at depths of 50–600 m (160–1,970 ft) and conducts a diel vertical migration, spending the day in deeper water and moving into shallower waters at night. Off northeastern Brazil, large numbers congregate around seamounts of varying depth. A slender, streamlined species, the night shark typically reaches a length of 2 m (6.6 ft). It can be identified by its long pointed snout and large green eyes (when alive), and is dark grayish blue or brown above and white below.

Night sharks are quick, nocturnally active, schooling predators that feed mainly on small bony fishes and squid. Reproduction is viviparous as with the other members of its family; females mate during the summer and give birth to litters of usually 12–18 pups after a gestation period of a year. This deepwater species is not known to pose a danger to humans. It is caught incidentally by commercial tuna and swordfish longline fisheries in the western Atlantic, and also by a targeted longline fishery operating off northeastern Brazil. The night shark is highly valued for its fins, and additionally as a source of meat, liver oil, and fishmeal. However, most sharks caught off northeastern Brazil have been found to contain unsafe concentrations of mercury.

Because of its low reproductive rate and historically documented declines in areas such as the Caribbean, the night shark has been assessed as Vulnerable by the International Union for Conservation of Nature (IUCN) and the American Fisheries Society (AFS), and listed as a "Species of Concern" by the U.S. National Marine Fisheries Service (NMFS). A population assessment has indicated that this species is secure in the waters off the United States, but this may not be true elsewhere.

Taxonomy[edit]

The first scientific description of the night shark was published by Cuban zoologist Felipe Poey in 1868, as part of a series of papers entitled Repertorio fisico-natural de la isla de Cuba.[2] He based his description on a single set of jaws and gave it the name Hypoprion signatus.[3] In 1973, Leonard Compagno synonymized the genus Hypoprion with Carcharhinus. No type specimen has been designated for this species.[2] Its common name comes from the fact that it is mostly captured at night.[4]

Distribution and habitat[edit]

The distribution of the night shark extends along the outer continental shelves and upper continental slopes of the Atlantic Ocean, from the U.S. state of Massachusetts to Argentina in the west, including the Gulf of Mexico and the Caribbean Sea, and from Senegal to northern Namibia in the east. In United States waters, it is relatively common off North Carolina and Florida (particularly the Florida Straits) and rarer elsewhere.[5][6] There are questionable reports of this species off the Pacific coast of Panama.[2]

The night shark is a deepwater species that has been reported from as far down as 2 km (1.2 mi), though it occasionally ventures to within 26 m (85 ft) of the surface.[5] Off the southeastern United States, it is usually caught at a depth range of 50–600 m (160–1,970 ft).[3] Off northeastern Brazil, the night shark is most commonly found near the summits of seamounts ranging from 38 m (125 ft) to 370 m (1,210 ft) deep.[1] Off West Africa, it occurs at depths of 90–285 m (295–935 ft), where the temperature is 11–16° C (52–61° F), the salinity is 36 ppt, and the dissolved oxygen level is 1.81 ml/l. Annual variation in Cuban catch rates may indicate a seasonal migration.[2]

Description[edit]

pencil drawing of a shark and a triangular, serrated tooth with an angled tip
Drawing of a night shark and its tooth.
The eyes of the night shark are bright green in life.

The night shark has a slender build with an elongated, pointed snout. The nares are flanked by moderately developed flaps of skin. The eyes are large, circular, and green in life, with irregularly shaped pupils and a nictitating membrane (protective third eyelid).[2][7] The mouth lacks conspicuous furrows at the corners and usually bears 15 tooth rows on either side of both jaws, plus 1–2 upper and 1 lower symphysial (jaw midline) tooth rows. Each upper tooth has a smooth to serrated edge, a narrow cusp becoming more oblique towards the corner of the mouth, and 2–5 coarse serrations at the base of the trailing margin.[4] The number and size of serrations on the leading margin of the tooth cusp increase relative to those on the trailing margin as the animal grows older.[3] The lower teeth are upright and smooth-edged.[2] The five pairs of gill slits are rather short.[7]

The pectoral fins are less than a fifth as long as the total body length and taper towards a somewhat rounded tip. The first dorsal fin is relatively small, triangular, and pointed, originating over the free rear tips of the pectoral fins. The second dorsal fin is much smaller than the first and originates over or slightly ahead of the anal fin. There is a ridge running between the dorsal fins.[2][7] The dermal denticles are not tightly packed and overlap each other minimally.[4] Each denticle is diamond-shaped with horizontal ridges leading to marginal teeth, the number increasing from 3 in juveniles to 5–7 in adults.[3] The coloration is grayish blue or brown above and whitish below, without fin markings. There is a faint band on each side and sometimes small black spots scattered over the back.[2][7] This species usually grows to 2.0 m (6.6 ft) long, but has been recorded reaching a length and weight of 2.8 m (9.2 ft) and 76.7 kg (169 lb) respectively.[6]

Biology and ecology[edit]

Fast and energetic, the night shark feeds primarily on small, active bony fishes such as mullet, mackerel, butterfish, sea basses, and flyingfish. Squid and shrimp are also sometimes taken. Most feeding activity occurs at night, hence its common name, with peaks at dawn and dusk.[2][3] Catch records indicate that this species is usually found in schools and conducts a diel vertical migration, spending the day at a depth of 275–366 m (902–1,201 ft) and moving up to shallower than 183 m (600 ft) at night.[1] Ovulating and gravid females are rarely ever caught, suggesting that during this period they may stop feeding or segregate themselves from others of their species.[8] Potential predators of the night shark include larger sharks.[4] Known parasites include the copepods Kroyeria caseyi, which attach to the gills,[9] Pandarus bicolor and P. smithii, which infest the skin,[4][10] and the tapeworms Heteronybelinia yamagutii, H. nipponica and Progrillotia dollfusi, which are found in the spiral valve intestine.[11] Another parasite is an undescribed isopod similar to Aega webbii. The common remora (Remora remora) may be found attached to this species.[3]

a small, big-eyed gray shark lying on its side on a piece of wood
A juvenile night shark; after birth young sharks grow quickly, thereby reducing their risk of predation.

Like other members of its family, the night shark is viviparous: once the developing embryos exhaust their supply of yolk, the depleted yolk sac is converted into a placental connection through which the mother delivers nourishment. Adult females have a single functional ovary (on the right) and two functional uteruses, which are divided into separate compartments for each embryo. Within the uterus the embryos lie lengthwise with their heads pointing the same direction as their mother.[8] Most information known about the night shark's life history comes from the subpopulation off northeastern Brazil, and may not hold true in other parts of the species range. Northeastern Brazilian sharks mate throughout the summer,[1] with the males biting at the female's body and fins as a prelude to copulation.[8]

After a year-long gestation period, females give birth to 4–18 (usually 12 or more) pups.[12] Embryos at varying stages of development have been found in both February and June, suggesting that the parturition takes place over a span of several months.[8] An important nursery area is believed to exist at the continental shelf break at 34°S latitude, near the southern extreme of this species' range.[1] The newborn young measure 50–72 cm (20–28 in) long,[5][12] and add around 25 cm (9.8 in) or 38% of their body length in their first year. This fast rate of growth serves to shorten the period immediately after birth when the small pups are most vulnerable to predators, a strategy similar to that employed by the silky shark (C. falciformis). By the time the sharks reach adulthood, the growth rate slows to a more modest 8.6 cm (3.4 in) per year. There is no difference in growth rate between sexes. Males mature sexually at a length of 1.8–1.9 m (5.9–6.2 ft), corresponding to an age of 8 years, and females at a length of 2.0–2.1 m (6.6–6.9 ft), corresponding to an age of 10 years.[13] The oldest known individuals are 17 years old; based on growth curves the maximum lifespan has been estimated at 28 years for males and 30 years for females.[5]

Human interactions[edit]

Because of its deepwater habitat, the night shark is not known to pose a danger to humans.[4] This species is prized for its large fins, which are exported for use in shark fin soup, and is also utilized as a source of meat, liver oil, and fishmeal.[2] Traditionally it has comprised a part of the bycatch of pelagic longline fisheries targeting swordfish (Xiphius gladius) and tuna in the western Atlantic. Since 1991, it has also been the focus of a longline fishery operating over seamounts off northeastern Brazil, where large numbers of sharks congregate and are easily captured. Some 90% of the seamount shark and ray catch in this area now consists of night sharks; of those approximately 89% are juveniles.[1][13] However, a study has found that night sharks from off northeastern Brazil accumulate high levels of mercury within their bodies, likely from their piscivorous diet. Some 92% of sharks examined contained mercury levels higher than that allowed for marketed carnivorous fish set by the Brazilian legislature, and the average mercury concentration was 1.742 mg/kg.[14] Therefore, eating only 0.1 kg (0.22 lb) of night shark meat per day could result in the ingestion of several times the daily mercury content judged safe by the World Health Organization.[14]

The International Union for Conservation of Nature (IUCN) has assessed the night shark globally as Vulnerable, citing its slow reproductive rate and historical declines under fishing pressure. It has also been listed as Vulnerable by the American Fisheries Society (AFS).[15] This species was once a significant part of the Cuban artisanal shark fishery, comprising 60–75% of the catch from 1937 to 1941, before its numbers dropped substantially in the 1970s. Similarly, the proportion of night sharks in the shark catch of the southeastern U.S. pelagic longline fishery fell from 26.1% from 1981 to 1983 to 0.3–3.3% in 1993 and 1994; a comparable decline was observed in catches by south Florida marlin tournaments since the 1970s.[1] Currently, the intense Brazilian targeted fishery is of particular concern, although fishing pressure on the night shark may be relaxing as the fishery is beginning to shift towards swordfish and bigeye tuna (Thunnus obesus). No fishery information on the night shark is available for the eastern Atlantic, leading to an IUCN assessment of Data Deficient for that region.[1]

In 1997, the U.S. National Oceanographic and Atmospheric Administration (NOAA) National Marine Fisheries Service (NMFS) listed the night shark as a "Species of Concern", meaning that it merits conservation concern but there is insufficient evidence for listing on the Endangered Species Act (ESA). In 1999, the NMFS Fishery Management Plan (FMP) of the Atlantic tunas, swordfish, and sharks was revised to prohibit the retention of 19 species, including the night shark. The prohibition of this species was upheld by Amendment 1 of the FMP, added in 2003.[15] Night sharks suffer high bycatch mortality on longlines, and prohibited or not some are kept by fishers because of their value and the difficulty of identifying disembodied parts to species. Nevertheless, a 2003–2008 NMFS population assessment concluded that night shark population in United States waters has stabilized (perhaps even increasing)[16] and no longer merits categorization as a "Species of Concern", though recommended that the prohibition on retention be maintained as a precautionary measure. This species should also benefit from the imposition of time/area closures in the Florida Straits and on the Charleston Bump.[1] Off Brazil and elsewhere, fishing continues largely unmanaged. IUCN members have urged that Brazil improve catch monitoring and enforcement of existing regulations, declare some critical habitat off-limits, and implement the Brazilian National Plan of Action for Sharks (NPOA-Sharks) under the FAO International Plan of Action for the Conservation and Management of Sharks (IPOA-Sharks).[1]

References[edit]

  1. ^ a b c d e f g h i j Santana, F.M., R. Lessa and J. Carlson (2006). Carcharhinus signatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved September 14, 2009.
  2. ^ a b c d e f g h i j Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 499–500. ISBN 92-5-101384-5. 
  3. ^ a b c d e f Raschi, W., J.A. Musick and L.J.V. Compagno (February 23, 1982). "Hypoprion bigelowi, a Synonym of Carcharhinus signatus (Pisces: Carcharhinidae), with a Description of Ontogenetic Heterodonty in This Species and Notes on Its Natural History". Copeia (American Society of Ichthyologists and Herpetologists) 1982 (1): 102–109. doi:10.2307/1444274. JSTOR 1444274. 
  4. ^ a b c d e f Barzan, K. Biological Profiles: Night Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on September 14, 2009.
  5. ^ a b c d Carlson, J., E. Cortés, J.A. Neer, C.T. McCandless and L.R. Beerkircher (2008). "The Status of the United States Population of Night Shark, Carcharhinus signatus". Marine Fisheries Review 70 (1): 1–13. 
  6. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Carcharhinus signatus" in FishBase. September 2009 version.
  7. ^ a b c d McEachran, J.D. and J.D. Fechhelm (1998). Fishes of the Gulf of Mexico: Myxiniformes to Gasterosteiformes. University of Texas Press. p. 86. ISBN 0-292-75206-7. 
  8. ^ a b c d Hazin, F.H., F. Lucena, T.S.L. Souza, C.Boeckman, M.Broadhurst and R. Menni (2000). "Maturation of the night shark, Carcharhinus signatus, in the south-western equatorial Atlantic Ocean". Bulletin of Marine Science 66 (1): 173–185. 
  9. ^ Benz, G.W. and G.B. Deets (1986). "Kroyeria caseyi sp. nov. (Kroyeriidae: Siphonostomatoida), a parasitic copepod infesting gills of night sharks (Carcharhinus signatus (Poey, 1868)) in the western north Atlantic". Canadian Journal of Zoology 64 (11): 2492–2498. doi:10.1139/z86-369. 
  10. ^ Montu, M.A. (1996). "Records of parasitic copepods of sharks from the southwestern Atlantic". Nauplius 4: 179–180. 
  11. ^ Knoff, M., S.C. de Sao Clemente, R.M. Pinto and D.C. Gomes (July 2002). "Prevalence and intensity of infection of cestodes Trypanorhyncha from elasmobranchs in the states of Parana and Santa Catarina, Brazil". Parasitologia Latinoamericana 57 (3–4): 149–157. 
  12. ^ a b Compagno, L.J.V., M. Dando and S. Fowler (2005). Sharks of the World. Princeton University Press. p. 306. ISBN 978-0-691-12072-0. 
  13. ^ a b Santana, F.M. and R. Lessa (January 2004). "Age determination and growth of the night shark (Carcharhinus signatus) off the northeastern Brazilian coast". Fishery Bulletin 102 (1): 156–167. 
  14. ^ a b Ferreira, A.G., V.V. Faria, C.E.V. de Carvalho R.P. Teixeira Lessa and F.M.S. da Silva (August 2004). "Total mercury in the night shark, Carcharhinus signatus in the western equatorial Atlantic Ocean". Brazilian Archives of Biology and Technology 47 (4): 629–634. doi:10.1590/s1516-89132004000400016. 
  15. ^ a b Bolden, S. (January 16, 2009). Species of Concern: Night Shark. NOAA Fisheries Office of Protected Resources: Proactive Conservation Program. Retrieved on September 14, 2009.
  16. ^ Cortes, E., C.A. Brown and L.R. Beerkircher (August 2007). "Relative abundance of pelagic sharks in the western North Atlantic Ocean, including the Gulf of Mexico and Caribbean Sea". Gulf and Caribbean Research 19 (2): 37–52. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Historically referred to as Hypoprion signatus, H. longirostris, and Carcharias signatus (Tee-van et al. 1948, Voss et al. 1969).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!