Overview

Comprehensive Description

Biology

Adults occur in seagrass beds, coral or rocky reefs and sandy areas. Also found around mangrove shores and sponge beds; less common on flourishing coral reefs (Ref. 26938). They remain within 50 cm from the substrate. Adults feed on algae, polychaetes, amphipods, foraminiferans and gastropods while juveniles feed on harpacticoid copepods, nemerteans and polychaetes (Ref. 9626). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Caught incidentally in traps and small-meshed beach nets (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: including southern Florida (USA), Bermuda, and northern Gulf of Mexico to Brazil.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Maine, including southern Florida (USA), Bermuda, and northern Gulf of Mexico to Brazil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 13 - 16; Analspines: 2; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

10.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Caudal fin slightly forked, with rounded lobes. Dark blue or brown above, yellow below, without obvious narrow vertical lines. Dark spot near back of dorsal fin well above its base becomes smaller in larger fish (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range ? - 10 m (Ref. 27000)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 74 specimens in 1 taxon.
Water temperature and chemistry ranges based on 59 samples.

Environmental ranges
  Depth range (m): 0 - 57
  Temperature range (°C): 23.704 - 28.035
  Nitrate (umol/L): 0.161 - 2.722
  Salinity (PPS): 34.217 - 36.481
  Oxygen (ml/l): 4.454 - 4.694
  Phosphate (umol/l): 0.051 - 0.194
  Silicate (umol/l): 1.285 - 3.502

Graphical representation

Depth range (m): 0 - 57

Temperature range (°C): 23.704 - 28.035

Nitrate (umol/L): 0.161 - 2.722

Salinity (PPS): 34.217 - 36.481

Oxygen (ml/l): 4.454 - 4.694

Phosphate (umol/l): 0.051 - 0.194

Silicate (umol/l): 1.285 - 3.502
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in seagrass beds, coral or rocky reefs and sandy areas. Also found around mangrove shores and sponge beds; less common on flourishing coral reefs (Ref. 26938). Remains within 50 cm from the substrate. Adults feed on algae, polychaetes, amphipods, foraminiferans and gastropods (Ref. 5217); also other benthic and planktonic invertebrates and fish (Ref. 33). Juveniles feed on harpacticoid copepods, nemerteans and polychaetes (Ref. 9626). Territorial herbivore (Ref. 57616). Caught incidentally in traps and small-meshed beach nets (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Males guard and aerate the eggs (Ref. 205). The eggs are deposited inside empty shells or under stones or shell (Ref. 39478).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stegastes leucostictus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTCGGTGCCTGAGCTGGAATAGTTGGGACAGCTTTAAGCCTACTCATTCGGGCAGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTACAATGTAATTGTTACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGATTCGGAAACTGGCTTATTCCCTTGATGATCGGGGCCCCTGACATAGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCATTTCTTCTCCTACTTGCCTCTTCAGGTGTAGAAGCAGGTGCCGGGACAGGATGGACAGTTTACCCCCCACTATCTGGTAATCTAGCCCACGCAGGAGCCTCCGTTGATTTAACAATTTTTTCCCTACACTTAGCAGGCATCTCATCCATCTTAGGTGCAATTAACTTTATCACTACCATTATTAATATAAAACCTCCTGCCATTTCACAATACCAGACCCCTCTATTCGTCTGAGCAGTCCTAATCACCGCCGTTCTTCTACTCCTCTCCCTTCCCGTCCTGGCTGCCGGCATTACGATACTTCTTACCGATCGAAACCTAAACACCACATTCTTTGACCCTGCAGGAGGGGGGGATCCTATCCTCTACCAGCACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stegastes leucostictus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 292
Specimens with Barcodes: 301
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Stegastes leucostictus

Stegastes leucostictus is a species of damselfish found near the sea bed in shallow waters on the western fringes of the Atlantic Ocean. It is commonly known as the beau gregory or beaugregory.[2]

Contents

Description

Stegastes leucostictus is a fairly deep-bodied, oval, laterally compressed bony fish, and grows to about 10 cm (3.9 in) long. It is rather variable in colour, but is generally dark blue or brown along the top of the head and the ridge of the back and yellowish on the flanks. The large dorsal fin has 12 spines and 13 to 16 soft rays. The anal fin has two spines and 12 to 14 soft rays. The caudal fin has a shallow fork and the paired pectoral and pelvic fins have no spines. The mouth is set at the tip of the snout.[2]

A juvenile S. leucostictus has blue stripes and spots on its head and a dull blue sheen on the top of the head and the upper part of the front half of the body. It has a large, black eye-spot ringed in blue, centered where the dorsal fin spines join the soft rays. As the juvenile develops, this spot moves upwards onto the fin. Also, a dark spot just above each pectoral fin distinguishes this species from others in the genus.[3]

Distribution and habitat

S. leucostictus is found in shallow waters at depths down to about 10 m (33 ft) in the western Atlantic Ocean. Its range extends from Florida and the Gulf of Mexico south to Brazil. It is a demersal fish, normally remaining within 50 cm of the seabed. Its favoured habitats are seagrass meadows, rocky or coral reefs and sandy flats and it is sometimes found amongst mangroves.[2]

Biology

S. leucostictus feeds mainly on seaweed, but also consumes marine worms, amphipods, foraminiferans and gastropod molluscs.[2] A male damselfish guards a territory, but seldom interacts with its neighbours, although it will attack a male of the same species introduced in a bottle placed in its territory. Dominance is related to the quality of the territory it occupies. The owner of a high-quality territory exhibits dominance and if it is removed and a subservient male moves in, it in turn develops dominance.[4]

During the breeding season, a male and a female form a pair bond. The eggs are hidden inside an empty shell or under a stone, and the male guards the nest and fans the eggs with its fins to keep them well oxygenated.[5]

The bluehead eats the eggs of S. leucostictus.

The wrasse, Thalassoma bifasciatum (bluehead), preys upon the eggs of S. leucostictus. A male damselfish can evaluate the level of the threat posed by one or more wrasse and react appropriately. It either chases the other fish, harries it, or adopts a head-lowered, threatening posture.[6]

References

  1. ^ Bailly, Nicolas (2010). "Stegastes leucostictus (Müller & Troschel, 1848)". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=159291. Retrieved 2011-12-26.
  2. ^ a b c d Stegastes leucostictus (Castelnau, 1855) FishBase. Retrieved 2011-12-26.
  3. ^ Stegastes leucostictus Pomacentridae. Retrieved 2011-12-27.
  4. ^ Cleveland A. L. et al. "Dominance relationships between male territorial neighbors in the beaugregory damselfish (Stegastes leucostictus)". Behaviour 140 (8/9). http://www.jstor.org/pss/4536076. Retrieved 2011-12-29.
  5. ^ Breder, C.M.; D.E. Rosen (1966). Modes of reproduction in fishes. Neptune City, New Jersey: T.F.H. Publications.
  6. ^ Haley, Michal P.; Christian R Müller (2002). "Territorial behaviour of beaugregory damselfish (Stegastes leucostictus) in response to egg predators". Journal of Experimental Marine Biology and Ecology 273 (2): 151–159. doi:10.1016/S0022-0981(02)00144-2. http://www.sciencedirect.com/science/article/pii/S0022098102001442. Retrieved 2011-12-29.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!