Overview

Comprehensive Description

Early juvenile markings: New recruits (10-15 mm SL) of S. leucostictus have a pattern of blue stripes and spots on the head and upper body with a broad stripe and two spots on the iris. The upper part of the head and anterior body have a dusky blue background color. The blue stripes and spots are heavier than in other conspecifics and usually there is a third line of blue spots between the top stripe on the head and the stripe directly off the upper eye. Furthermore, the stripes typically break up into a pattern of numerous bright spots on the anterior dorsal fin. There is a large black ocellus ringed in blue centered on the last two dorsal-fin spines and first three dorsal-fin soft rays. The ocellus is typically mostly on the fin (usually 70% or more) and often higher than wide. There is usually one unmarked scale row between the lateral line and the blue ring. In addition, the scales with blue below the ocellus on the body are darkly-outlined rather than merged into a blue line. The spot migrates rapidly onto the fin and, by the time the juveniles reach 20 mm SL, almost all of the black spot is over the dorsal fin. There is a dark spot at the top edge of the pectoral-fin base. There is no caudal-peduncle saddle spot.

Later juveniles (over 20 mm SL) are yellow with a blue (often bright blue) upper head and anterior body and dorsal fin with numerous iridescent blue stripes and spots, a dorsal-fin ocellus mostly off of the body (often completely over the fin rays and subsequently the edges becoming indistinct and disappearing), a spot at the top of the pectoral-fin base, and no caudal-peduncle saddle. Some juvenile damselfishes are identical in all respects to these S. leucostictus, but do have a caudal-peduncle saddle, and these are automatically assigned to S. variabilis (DNA sequencing should confirm this conclusion).

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults occur in seagrass beds, coral or rocky reefs and sandy areas. Also found around mangrove shores and sponge beds; less common on flourishing coral reefs (Ref. 26938). They remain within 50 cm from the substrate. Adults feed on algae, polychaetes, amphipods, foraminiferans and gastropods while juveniles feed on harpacticoid copepods, nemerteans and polychaetes (Ref. 9626). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Caught incidentally in traps and small-meshed beach nets (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Maine, including southern Florida (USA), Bermuda, and northern Gulf of Mexico to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: including southern Florida (USA), Bermuda, and northern Gulf of Mexico to Brazil.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 13 - 16; Analspines: 2; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

10.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: Damselfishes with 12 dorsal-fin spines and a mode of 15-16 soft rays indicate Stegastes and Microspathodon chrysurus. Fin-ray counts broadly overlap among Stegastes with most species having 13-14 soft anal-fin rays and 18-20 pectoral-fin rays (S. adustus and M. chrysurus have a mode of 21 pectoral-fin rays). Given this overlap, larvae and even early juveniles can require DNA sequencing to reliably distinguish the species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caudal fin slightly forked, with rounded lobes. Dark blue or brown above, yellow below, without obvious narrow vertical lines. Dark spot near back of dorsal fin well above its base becomes smaller in larger fish (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Juvenile analogues: New recruits of S. leucostictus are separated from S. planifrons and S. adustus by having stripes along with the spots on the head and iris and from S. partitus by having a dorsal-fin ocellus. The more difficult separation of new recruits (up to 15 mm SL) from S. variabilis and S. diencaeus depends on subtle characters, primarily the dorsal-fin ocellus centered off the body, usually more than 70% over the dorsal fin. In S. leucostictus, there is a space about one scale wide between the blue ring edge and the lateral line, while in the other species the blue ring starts less than a scale above the lateral line. In addition, the blue ring segment below the dorsal-fin ocellus is made up of dark-edged scales in S. leucostictus and merged into a blue line on the other two species. On the head, the blue spots usually form a third row between the top head stripe and the upper-eye stripe, whereas in the other two species this additional row is reduced and appears later, after 15 mm SL. S. leucostictus recruits and juveniles do not have the caudal-peduncle saddle spot, thus its presence excludes S. leucostictus (the absence of the saddle means little in new recruits, when S. variabilis may not yet have developed a saddle and when S. diencaeus variably shows none or a transient mark). Also S. leucostictus recruits and juveniles always show the dark spot at the top of the pectoral fin, thus the absence of the spot excludes S. leucostictus, but its presence does not exclude the other species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range ? - 10 m (Ref. 27000)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 74 specimens in 1 taxon.
Water temperature and chemistry ranges based on 59 samples.

Environmental ranges
  Depth range (m): 0 - 57
  Temperature range (°C): 23.704 - 28.035
  Nitrate (umol/L): 0.161 - 2.722
  Salinity (PPS): 34.217 - 36.481
  Oxygen (ml/l): 4.454 - 4.694
  Phosphate (umol/l): 0.051 - 0.194
  Silicate (umol/l): 1.285 - 3.502

Graphical representation

Depth range (m): 0 - 57

Temperature range (°C): 23.704 - 28.035

Nitrate (umol/L): 0.161 - 2.722

Salinity (PPS): 34.217 - 36.481

Oxygen (ml/l): 4.454 - 4.694

Phosphate (umol/l): 0.051 - 0.194

Silicate (umol/l): 1.285 - 3.502
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in seagrass beds, coral or rocky reefs and sandy areas. Also found around mangrove shores and sponge beds; less common on flourishing coral reefs (Ref. 26938). Remains within 50 cm from the substrate. Adults feed on algae, polychaetes, amphipods, foraminiferans and gastropods (Ref. 5217); also other benthic and planktonic invertebrates and fish (Ref. 33). Juveniles feed on harpacticoid copepods, nemerteans and polychaetes (Ref. 9626). Territorial herbivore (Ref. 57616). Caught incidentally in traps and small-meshed beach nets (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Males guard and aerate the eggs (Ref. 205). The eggs are deposited inside empty shells or under stones or shell (Ref. 39478).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stegastes leucostictus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTCGGTGCCTGAGCTGGAATAGTTGGGACAGCTTTAAGCCTACTCATTCGGGCAGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTACAATGTAATTGTTACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGATTCGGAAACTGGCTTATTCCCTTGATGATCGGGGCCCCTGACATAGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCATTTCTTCTCCTACTTGCCTCTTCAGGTGTAGAAGCAGGTGCCGGGACAGGATGGACAGTTTACCCCCCACTATCTGGTAATCTAGCCCACGCAGGAGCCTCCGTTGATTTAACAATTTTTTCCCTACACTTAGCAGGCATCTCATCCATCTTAGGTGCAATTAACTTTATCACTACCATTATTAATATAAAACCTCCTGCCATTTCACAATACCAGACCCCTCTATTCGTCTGAGCAGTCCTAATCACCGCCGTTCTTCTACTCCTCTCCCTTCCCGTCCTGGCTGCCGGCATTACGATACTTCTTACCGATCGAAACCTAAACACCACATTCTTTGACCCTGCAGGAGGGGGGGATCCTATCCTCTACCAGCACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stegastes leucostictus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 292
Specimens with Barcodes: 301
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Stegastes leucostictus

Stegastes leucostictus is a species of damselfish found near the sea bed in shallow waters on the western fringes of the Atlantic Ocean. It is commonly known as the beau gregory or beaugregory.[2]

Description[edit]

Stegastes leucostictus is a fairly deep-bodied, oval, laterally compressed bony fish, and grows to about 10 cm (3.9 in) long. It is rather variable in colour, but is generally dark blue or brown along the top of the head and the ridge of the back and yellowish on the flanks. The large dorsal fin has 12 spines and 13 to 16 soft rays. The anal fin has two spines and 12 to 14 soft rays. The caudal fin has a shallow fork and the paired pectoral and pelvic fins have no spines. The mouth is set at the tip of the snout.[2]

A juvenile S. leucostictus has blue stripes and spots on its head and a dull blue sheen on the top of the head and the upper part of the front half of the body. It has a large, black eye-spot ringed in blue, centered where the dorsal fin spines join the soft rays. As the juvenile develops, this spot moves upwards onto the fin. Also, a dark spot just above each pectoral fin distinguishes this species from others in the genus.[3]

Distribution and habitat[edit]

S. leucostictus is found in shallow waters at depths down to about 10 m (33 ft) in the western Atlantic Ocean. Its range extends from Florida and the Gulf of Mexico south to Brazil. It is a demersal fish, normally remaining within 50 cm of the seabed. Its favoured habitats are seagrass meadows, rocky or coral reefs and sandy flats and it is sometimes found amongst mangroves.[2]

Biology[edit]

S. leucostictus feeds mainly on seaweed, but also consumes marine worms, amphipods, foraminiferans and gastropod molluscs.[2] A male damselfish guards a territory, but seldom interacts with its neighbours, although it will attack a male of the same species introduced in a bottle placed in its territory. Dominance is related to the quality of the territory it occupies. The owner of a high-quality territory exhibits dominance and if it is removed and a subservient male moves in, it in turn develops dominance.[4]

During the breeding season, a male and a female form a pair bond. The eggs are hidden inside an empty shell or under a stone, and the male guards the nest and fans the eggs with its fins to keep them well oxygenated.[5]

The bluehead eats the eggs of S. leucostictus.

The wrasse, Thalassoma bifasciatum (bluehead), preys upon the eggs of S. leucostictus. A male damselfish can evaluate the level of the threat posed by one or more wrasse and react appropriately. It either chases the other fish, harries it, or adopts a head-lowered, threatening posture.[6]

References[edit]

  1. ^ Bailly, Nicolas (2010). "Stegastes leucostictus (Müller & Troschel, 1848)". World Register of Marine Species. Retrieved 2011-12-26. 
  2. ^ a b c d Stegastes leucostictus (Castelnau, 1855) FishBase. Retrieved 2011-12-26.
  3. ^ Stegastes leucostictus Pomacentridae. Retrieved 2011-12-27.
  4. ^ Cleveland A. L. et al. "Dominance relationships between male territorial neighbors in the beaugregory damselfish (Stegastes leucostictus)". Behaviour 140 (8/9). doi:10.1163/156853903322589623. Retrieved 2011-12-29. 
  5. ^ Breder, C.M.; D.E. Rosen (1966). Modes of reproduction in fishes. Neptune City, New Jersey: T.F.H. Publications. 
  6. ^ Haley, Michal P.; Christian R Müller (2002). "Territorial behaviour of beaugregory damselfish (Stegastes leucostictus) in response to egg predators". Journal of Experimental Marine Biology and Ecology 273 (2): 151–159. doi:10.1016/S0022-0981(02)00144-2. Retrieved 2011-12-29. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!