Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found in coastal waters over sand near reefs. Feeds on crustaceans and fishes (Ref. 5213). Edible but spoils easily.
  • Smith, M.M. and R.J. McKay 1986 Haemulidae. p. 564-571. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Pomadasys maculatus is found throughout the Indian Ocean and the Red Sea, and in the western Pacific from China and Taiwan, south to Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: throughout the Indian Ocean (Ref. 11441) and the western Pacific, north to China, south to Australia.
  • Roux, C. 1986 Pomadasyidae. p. 327-330. In J. Daget, J.-P. Gosse and D.F.E. Thys van den Audenaerde (eds.) Check-list of the freshwater fishes of Africa (CLOFFA). ISNB, Brussels; MRAC, Tervuren; and ORSTOM, Paris. Vol. 2. (Ref. 2135)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa and Madagascar east to Philippines and New Guinea, north to southern Japan, south to Shark Bay (Western Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 13 - 14; Analspines: 3; Analsoft rays: 7
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 593 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

59.3 cm TL (male/unsexed; (Ref. 3626)); max. published weight: 3,200 g (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Edwards, R.R.C. and S. Shaher 1991 The biometrics of marine fishes from the Gulf of Aden. Fishbyte 9(2):27-29. (Ref. 3626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found in coastal waters over sand near reefs. Feeds on crustaceans and fish (Ref. 5213).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Small-sized fish of moderately deep body. Isthmus narrow, forming a groove. Chin with 2 pairs or small pores. This species is characterized by several dark large elongate blotches on the upper back, one forming a saddle on the nape.
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The grunt, Pomadasys maculatus, is an amphidromous species that is found in coastal inshore waters at a depth range of 20–110 m. It inhabits sandy bottoms close to reefs, open bays, trawling grounds, and estuaries (FAO 2001). It feeds on crustaceans and fishes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; amphidromous (Ref. 51243); brackish; marine; depth range 20 - 110 m (Ref. 12260)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Pauly, D., A. Cabanban and F.S.B. Torres Jr. 1996 Fishery biology of 40 trawl-caught teleosts of western Indonesia. p. 135-216. In D. Pauly and P. Martosubroto (eds.) Baseline studies of biodiversity:the fish resource of western Indonesia. ICLARM Studies and Reviews 23. (Ref. 12260)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 187 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 4 - 125.5
  Temperature range (°C): 20.087 - 28.013
  Nitrate (umol/L): 0.048 - 21.453
  Salinity (PPS): 32.901 - 36.219
  Oxygen (ml/l): 0.953 - 4.725
  Phosphate (umol/l): 0.064 - 1.837
  Silicate (umol/l): 0.567 - 14.825

Graphical representation

Depth range (m): 4 - 125.5

Temperature range (°C): 20.087 - 28.013

Nitrate (umol/L): 0.048 - 21.453

Salinity (PPS): 32.901 - 36.219

Oxygen (ml/l): 0.953 - 4.725

Phosphate (umol/l): 0.064 - 1.837

Silicate (umol/l): 0.567 - 14.825
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 20 - 110m.
From 20 to 110 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters of the continental shelf (Ref. 75154). Often found in sandy or muddy areas. Feeds on crustaceans and fishes (Ref. 9137).
  • Smith, M.M. and R.J. McKay 1986 Haemulidae. p. 564-571. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomadasys maculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCCTGGGCTGGTATGGTAGGCACAGCCCTAAGCCTGCTCATCCGAGCAGAACTCAGCCAACCGGGTGCACTCCTCGGGGACGACCAGATTTATAACGTAATCGTTACTGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCTATTCTAATTGGTGGTTTCGGAAACTGACTCGTGCCCCTAATGATTGGAGCGCCTGATATGGCATTCCCTCGGATGAACAACATGAGTTTTTGACTACTTCCCCCCTCTTTCCTCCTTCTACTTGCCTCTTCAGGGGTTGAGGCTGGGGCCGGAACCGGATGAACAGTTTACCCACCTTTAGCCGGCAACCTCGCCCACGCAGGAGCATCAGTTGACCTAACCATTTTCTCCCTTCACTTGGCGGGTGTTTCCTCAATCCTCGGGGCAATTAACTTCATTACAACAATTATCAACATAAAACCCCCTGCAATCTCCCAATACCAGACCCCTCTTTTCGTCTGATCTGTACTAGTAACTGCCGTCTTACTACTTCTTTCCCTCCCAGTCCTAGCCGCTGGCATTACAATGCTTCTGACAGACCGAAACCTAAATACTACCTTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTGTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pomadasys maculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M. (Sampled Red List Index Coordinating Team)

Reviewer/s
Carpenter, K.E., Livingstone, S. & Polidoro, B.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Pomadasys maculatus has been assessed as Least Concern. Although this species is fished commercially and taken as by-catch in prawn trawls, this is not known throughout its entire broad distribution, and there is no information to suggest that this is causing a significant decline in population size at present. This species may also be impacted by pollution and habitat degradation, but these are likely to be localised threats only. Monitoring of the harvest and by-catch levels, the extent of harvest, and habitat status of this species is needed, to determine if these threats are likely to cause significant population declines in the future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Pomadasys maculatus is commonly found on prawn trawl grounds (FAO 2001).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Pomadasys maculatus is fished commercially and is taken by bottom trawl, handline, set net, trap, and spear (FAO 2001). It is also likely that this species is taken as by-catch by prawn trawl fisheries operating within its range.

This species may also suffer localised declines due to habitat degradation and pollution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Pomadasys maculatus, however its distribution may coincide with numerous marine protected areas.

Monitoring of the harvest and by-catch levels, the extent of harvest, and habitat status of this species is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • McKay, R.J. 1984 Haemulidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 2. FAO, Rome. pag. var. (Ref. 3412)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!