Overview

Comprehensive Description

Biology

Occur in rocky reefs and boulder fields (Ref. 27437), the young found in shallower regions (Ref. 27436). Feed on fishes and crustaceans (Ref. 28499). Viviparous (Ref. 34817). Sold as fillets (Ref. 6885).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Gulf of Alaska to northern Baja California, Mexico.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 16; Analspines: 3; Analsoft rays: 5 - 8
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

104 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 17.8 kg (Ref. 40637); max. reported age: 118 years (Ref. 39247)
  • Cailliet, G.M., A.H. Andrews, E.J. Burton, D.L. Watters, D.E. Kline and L.A. Ferry-Graham 2001 Age determination and validation studies of marine fishes: do deep-dwellers live longer?. Exp. Geront. 36:739-764. (Ref. 39247)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Head spines very strong to strong - nasal, preocular, supraocular, postocular, tympanic and parietal spines present, coronal and nuchal spines usually present (Ref. 27437). Raspy ridges on older fish (Ref. 27437). Caudal fin rounded (Ref. 6885). Orange red to orange yellow in color; eye bright yellow; fins may have black tips; adults usually with light to white stripe on lateral line; juveniles with 2 light stripes, one on lateral line and a shorter one below lateral line (Ref. 27437).
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 15 - 549 m (Ref. 27437)
  • Kramer, D.E. and V.M. O'Connell 1995 Guide to Northeast Pacific rockfishes. Genera Sebastes and Sebastolobus. Alaska Sea Grant, Marine Advisory Bulletin No. 25. (Ref. 27437)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 49 - 49
  Temperature range (°C): 8.705 - 8.705
  Nitrate (umol/L): 13.007 - 13.007
  Salinity (PPS): 32.561 - 32.561
  Oxygen (ml/l): 5.506 - 5.506
  Phosphate (umol/l): 1.398 - 1.398
  Silicate (umol/l): 21.984 - 21.984
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 112 specimens in 1 taxon.
Water temperature and chemistry ranges based on 50 samples.

Environmental ranges
  Depth range (m): 7.5 - 421.5
  Temperature range (°C): 5.424 - 10.428
  Nitrate (umol/L): 5.899 - 37.822
  Salinity (PPS): 32.560 - 34.027
  Oxygen (ml/l): 1.332 - 6.027
  Phosphate (umol/l): 0.879 - 2.880
  Silicate (umol/l): 10.039 - 70.929

Graphical representation

Depth range (m): 7.5 - 421.5

Temperature range (°C): 5.424 - 10.428

Nitrate (umol/L): 5.899 - 37.822

Salinity (PPS): 32.560 - 34.027

Oxygen (ml/l): 1.332 - 6.027

Phosphate (umol/l): 0.879 - 2.880

Silicate (umol/l): 10.039 - 70.929
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 15 - 549m.
From 15 to 549 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 118 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes ruberrimus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCCACTAATCACAAAGACATCGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGAC---GACCAAATTTATAATGTAATCGTTACAGCGCATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATAATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTACCCCCTTCTTTCCTTCTACTACTTGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGATGAACAGTGTATCCGCCCCTGGCTGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTTGGGGCAATCAATTTTATTACCACAATTATTAATATAAAACCCCCGGCCATCTCTCAGTACCAAACACCCCTATTTGTATGAGCCGTCCTAATTACCGCTGTTCTTCTCCTCCTCTCTCTWCCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCAGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTTTTTGGGCACCCAGAGGTATATATTCTTATTCTGCCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTATTCTGGTAAAAAAGAACCCTTTGGCTATATAGGAATAGTATGGGCAATAATAGCTATTGGCCTCCTAGGCTTTATTGTATGAGCCCATCACATGTTCACAGTTGGCATGGACGTAGACACGCGTGCTTATTTCACATCTGCCACAATAATCATCGCAATTCCCACCGGTGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGAGGC---TCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes ruberrimus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yelloweye rockfish

The yelloweye rockfish (Sebastes ruberrimus) is a rockfish of the genus Sebastes, and one of the biggest members of the genus. Its name derives from its coloration. It is also locally known as "red snapper",[1][2] not to be confused with the warm-water species Lutjanus campechanus that formally carries the name red snapper. The yelloweye is one of the world's longest-lived fish species, and is cited to live to a maximum of 114 to 120 years of age. As they grow older, they change in color, from reddish in youth, to bright orange in adulthood, to pale yellow in old age. Yelloweye live in rocky areas and feed on small fish and other rockfish. They reside in the East Pacific and range from Baja California to Prince William Sound in Alaska.

Yelloweye rockfish are prized for their meat, and were declared overfished in 2002, at which time a survey determined that their population, which had been in decline since the 1980s, was just 7-13% of numbers before commercial fishing of the species began. Because of the slow reproductive age of the species, recovery of the species is difficult, and liable to last decades, even with the harshest restrictions; Washington state, for example, maintains a quota of under 1000 individuals per year. It is currently under consideration for listing under Threatened or Endangered status.

Characteristics[edit]

A diagram of a Yellowfish, calling attention in particular to its head spines.

The yelloweye rockfish is colored red on its back, orange to yellow on the sides, and black on the fin tips. Its young are typically under 28 cm (11 in) in length, and differ from the adults in that they have two reddish-white stripes along their belly,[3] and are often red. Because of the distinct difference in coloration between juveniles and adults, they were considered separate species for a long time.[4] Its head spines are exceptionally strong. They grow to a maximum length of 36 in (0.9 m) and are typically found in the 28-to-215-fathom (51-to-393 m) range, although specimen have been reported up to a maximum depth of 260 fathoms (475 m).[3]

Yelloweye rockfish live to be extremely old, even for their unusually long-lived genus. They average 114[1] to 120[2] years of age; the oldest ones reach as much as 147 years. They fade from bright orange to a paler yellow as they grow in age. They are exceptionally slow developing as well, not reaching maturity until they are around 20 years of age.[1]


Diet[edit]

Larval yelloweye feed on diatoms, dinoflagellates, crustaceans, tintinnids, and cladocerans, and juveniles consume copepods and euphausiids of all life stages. Adults eat demersal invertebrates and small fishes, including other species of rockfish.[4]

Habitat[edit]

A yelloweye in its natural environment.

The yelloweye rockfish has been recorded all along the East Pacific, from Umnak Island and Prince William Sound, Alaska, to Ensenada, Baja California.[5] They are typically found in deeper, rocky-bottomed areas; in fact, they often spend their entire lifetime on a single rock pile.[2]

Value to fishing[edit]

Due to their large size and fillet quality, yelloweye rockfish are a highly prized species in both commercial and recreational fisheries. Historically, yelloweye are taken in by trawl, line, and sports gear. Fishing of the species using trawls was restricted following a 2000 resolution to keep trawlers out of their primary habitats.[6]

Yelloweye brought to the surface by fishing boats tend to die of decompression barotrauma and temperature shock. According to the Alaska Department of Fish and Game, the fish is liable to die if brought to the surface from a depth of over 10 fathoms (60 ft; 18 m).[6]

Recent federal research by John Hyde at National Oceanic and Atmospheric Administration's (NOAA's) Southwest Fisheries Science Center in San Diego indicates that, after a yelloweye is brought to the surface, devices which bring these fish back to 45 meters below the sea surface may allow the fish to recompress and survive, analogous to 'an ambulance ride home after an angler catches it.' The federal Pacific Fishery Management Council (PFMC) may begin considering proposals to compensate anglers for using these devices, as a means to restore fish stocks.[7]

Overfishing[edit]

The 20 fathoms (37 m) coastal limit for catching yelloweye, as defined at the coast of Washington state. Other states have a similar policy to protect the species.

A stock assessment of the species, which incorporated data gathered from northern California and Oregon, was done in 2001. The study concluded the fish's numbers are just 7% of what they would be without human intervention in northern California, and a slightly higher 13% in Oregon. The assessment also showed a 30-year decline in numbers. These numbers are far below the 25% threshold at which a fish is labeled "overfished." As a result, the yellowfish is separated from the assessment group of rockfish in general of which it was a part.[6]

Although efforts are being made to facilitate a recovery in numbers, a formal rebuilding of the species would take decades, as much as 100 years of recovery. This is associated with the fact that they do not reach sexual maturity until they are 10 to 20 years of age.[1][6] A total of 13.5 metric tons (29,800 lb) of yelloweye catch were allowed coastwide in 2002. This limit is set so that fisheries can potentially catch yelloweye if they are caught accidentally, but prevents the targeted fishing of the species. The Washington Department of Fish and Wildlife, meanwhile, prohibited retention of yelloweye rockfish caught by recreational fisheries. The Oregon Department of Fish and Wildlife and the California Department of Fish and Game both have a daily limit of one yelloweye rockfish. Commercial retention of the rockfish is prohibited except for a small 300 lb (136 kg) limit, to allow yellowfish caught dead to be retained.[6]

As time passed, the restrictions on fishing became stricter; the 2009 Washington state quota is just 6,000 pounds (2.7 t), fewer than 1000 fish. State departments are prepared to close down anglers hunting halibut to protect the species if the situation becomes dire.[2]

{http://www.nmfs.noaa.gov/pr/species/fish/yelloweyerockfish.htm They are listed as EPA Threatened. />

References[edit]

  1. ^ a b c d "Orion Charters - Rock Fish". 10/06/06. Retrieved 26 November 2009.  Check date values in: |date= (help)
  2. ^ a b c d "Protecting Washington’s Yelloweye Rockfish". Washington Department of Fish and Wildlife. 2009. Retrieved 26 November 2009. 
  3. ^ a b "Yelloweye rockfish". NOAA. Retrieved 26 November 2009. 
  4. ^ a b "Yelloweye Rockfish (Sebastes ruberrimus)". NOAA Office of Protected Resources. Retrieved 26 November 2009. 
  5. ^ "Sebastes ruberrimus". Oregon Department of Fish and Wildlife. Retrieved 26 November 2009. 
  6. ^ a b c d e "Avoid Yelloweye Rockfish". June 4, 2002. Retrieved 26 November 2009. 
  7. ^ Chen, Ingfei (June 13, 2011). "Putting Rockfish Back Where They Belong". Science. Retrieved November 6, 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!