Overview

Comprehensive Description

Biology

A pelagic cod adapted to close association with ice (cryopelagic)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dark bluish head and back with violet sheen; Protruding lower jaw; Deeply indented caudal fin with rounded tips; Lateral line with curves; Greatest body depth behind the head
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Occurs in coastal habitats during summer and winter (Ref. 1371). Cryopelagic or epontic, from surface down to 1383 m (Ref. 58426). In the Beaufort Sea, it may also be found in brackish lagoons and in almost fresh water in river mouths (Ref. 1371). Although associated with the occurrence of ice (White Sea), it is present in ice-free near-shore waters (Alaska) (Ref. 1371). Onshore-offshore movements are associated with spawning and movements of the ice (Ref. 27547). Feeds mostly on epibenthic mysids, also amphipods, copepods and fishes (Ref. 1371). Also caught with mid-water trawls (Ref. 1371). Utilized as fishmeal and source of oil (Ref. 1371). Euryhaline and eurythermic.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

North Atlantic: White Sea, Iceland, and southern Greenland into the Miramichi River, New Brunswick in Canada
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Canadian Exclusive Economic Zone [Arctic part], Davis Strait, European waters (ERMS scope), FAO fishing area 18, FAO fishing area 21, Greenlandic Exclusive Economic Zone, Gulf of St. Lawrence, Hudson Bay, Hudson Strait, North West Atlantic, Ungava Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Circumpolar distribution. In Arctic Ocean to the White Sea, Iceland, and southern Greenland, in the western Atlantic into the Miramichi River, New Brunswick, and in the Chukchi, Beaufort, and Bering Sea to Cape Olyutorski, the Pribilof Islands, and Bristol Bay (Allen and Smith 1988). Observed farther north than any other fish species (Dept. of Fisheries and Oceans Canada 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumpolar in the Arctic. North Atlantic: White Sea, Iceland, and southern Greenland into the Miramichi River, New Brunswick in Canada. North Pacific: Bering Sea to Cape Olyutorski, the Pribilof Islands, and Bristol Bay.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 42 - 57; Analspines: 0; Analsoft rays: 33 - 44; Vertebrae: 49 - 57
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm TL (male/unsexed; (Ref. 1371)); max. reported age: 7 years (Ref. 1371)
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Caudal fin deeply concave. Lower jaw slightly longer than upper jaw. Chin barbel very small. No lateral line pores on head. Scales small and embedded, not overlapping. Brownish along the back with many fine points; the sides and belly silvery; the fins dusky with pale margins (Ref. 1371).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Occurs in coastal habitats during summer and winter.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5007 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4125 samples.

Environmental ranges
  Depth range (m): 0.15 - 958.5
  Temperature range (°C): -2.072 - 20.092
  Nitrate (umol/L): 0.124 - 25.823
  Salinity (PPS): 23.837 - 36.742
  Oxygen (ml/l): 3.207 - 9.131
  Phosphate (umol/l): 0.060 - 2.356
  Silicate (umol/l): 1.077 - 49.842

Graphical representation

Depth range (m): 0.15 - 958.5

Temperature range (°C): -2.072 - 20.092

Nitrate (umol/L): 0.124 - 25.823

Salinity (PPS): 23.837 - 36.742

Oxygen (ml/l): 3.207 - 9.131

Phosphate (umol/l): 0.060 - 2.356

Silicate (umol/l): 1.077 - 49.842
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Inhabits a wide variety of marine habitats. Prefers cold temperatures (-1.8-10 degrees C) but tolerates variable water temperatures and high or variable salinities and turbidities (Craig et al. 1982, ADFG 1986, Cannon et al. 1991). Found most commonly at the water's surface, close to shore among ice floes, but also occur offshore at depths greater than 900 m. Species is associated with the undersurface and cracks in sea ice, but also found near the ocean bottom and throughout the water column in open water (ADFG 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 731m.
Recorded at 731 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Panarctic, endemic (only found in Arctic); One of the most northerly distributed fishes, collected near the North Pole; Cryopelagic or demersal; Brackish lagoons and river mouths to oceanic waters over deep central basins; Occasionally in large schools
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 400 m (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Observed in dense schools in open water in late summer and early winter prior to spawning. Migrates to nearshore waters in late summer as water salinity increases, and remains under nearshore ice in winter to spawn before moving offshore in spring (Craig 1984). Have been observed descending to greater depths and colder water when surface temperatures in the Barents Sea increased to 10 degrees C in late summer/early fall (Hognestad 1968, Ponomarenko 1968). Arctic cod from the northern Bering and southern Chukchi seas observed moving north with the receding ice edge (Lowry and Frost 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in coastal habitats during summer and winter (Ref. 1371). In the Beaufort Sea, it may also be found in brackish lagoons and in almost fresh water in river mouths (Ref. 1371). Although associated with the occurrence of ice (White Sea), it is present in ice-free near-shore waters (Alaska) (Ref. 1371). Onshore-offshore movements are associated with spawning and movements of the ice (Ref. 27547). Feeds mostly on epibenthic mysids, also amphipods, copepods and fishes (Ref. 1371). Preyed upon by marine mammals, seabirds (murres and black guillemots), fishes (Atlantic salmon, Arctic char, Atlantic cod, Greenland halibut and Greenland cod), harp seals, bearded seals, ringed seals, white whales and narwhals. Parasites of the species include Clavella adunca, Haemobaphes cyclopterina and Sphyrion lumpi (copepods) (Ref. 5951). Also caught with mid-water trawls (Ref. 1371).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Young-of-year (YOY) consume phytoplankton and very small or early stages of zooplankton; adults prey on pelagic zooplankton, substrate and ice-associated crustaceans, and occasionally young fish (ADFG 1986). Zooplankton taken primarily include copepods (Calanus spp.), amphipods (Themisto spp.), and mysids (Fechhelm et al. 1984; Hop et al. 1997). Often found near ice edges and boundaries between warm and cold water bodies where phytoplankton and zooplankton concentrate. May exhibit two behavior strategies: schooling or individual foraging (Hop et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A main consumer of plankton offshore in the Arctic; The main food of many marine mammals, seabirds, and some fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Boreogadus saida (arctic cod) is prey of:
Orcinus orca
Somniosus microcephalus
Alcidae
Phoca hispida
Monodon monoceros
Rissa
Procellariidae
Cepphus

Based on studies in:
Arctic (Marine)
Canada, high Arctic (Ice cap)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Boreogadus saida (arctic cod) preys on:
zooplankton
caplin
Calanoida
Parathemisto

Based on studies in:
Arctic (Marine)
Canada, high Arctic (Ice cap)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A keystone species in arctic ecosystems; a major trophic link between primary producers/zooplankters and upper trophic levels (Craig et al. 1982.). Human use includes harvest for fishmeal and a source of oil (Cohen et al. 1990). Associated with floating sea ice, under which it may spawn, forage, and seek protection in cracks; antifreeze glycoproteins synthesized in its liver aid survival in water below the equilibrium freezing point of body fluids (Gillispie 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Spawns between November and February under sea ice (Craig et al. 1982), but spawning may extend to mid-July in some areas (Wyllie-Echeverria et al. 1997). Annual schooling and migrations occur in fall/early winter to nearshore waters; in spring to offshore waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Spawns once per lifetime, averaging 11,900 eggs per female; Migrate to nearshore waters to spawn; Eggs and larvae are pelagic; Mature at 2-6 years depending on region and sex; Maximum age is 6-7 years
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish move close inshore, often in large numbers to spawn (Ref. 27547).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Age at sexual maturity about 2-3 years for males and 3 years for females in the Beaufort Sea and most other parts of its range (Craig et al. 1982); 4-5 years for both sexes in the White Sea (Cohen et al. 1990). Usually spawn no more than once in a lifetime, commonly under sea ice, between November and February (Craig et al. 1982) but may extend to mid-July in the northeastern Chukchi Sea (Wyllie-Echeverria et al. 1997). Eggs produced are the largest and fewest (average of 11,900 per female) of all species in the cod family (ADFG 1986, Cohen et al. 1990). Eggs are fertilized externally and dispersed in the water column. Incubation lasts 45-90 days, and varies with water temperature (Sameoto 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Boreogadus saida

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC4513-08|AM919428|Boreogadus saida| ACCCGCTGATTTTTCTCGACCAATCACAAAGACATTGGCACCCTTTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTA---AGCCTGCTCATTCGAGCAGAGCTAAGTCAACCTGGTGCACTCCTTGGTGAC---GATCAAATTTATAATGTGATCGTTACAGCGCACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTTGGAAACTGACTCATTCCTCTAATG---ATCGGTGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGCTTCTGACTTCTTCCTCCATCTTTCCTTCTCCTTTTAGCATCCTCTGGTGTAGAAGCTGGGGCTGGAACAGGCTGAACTGTATATCCTCCTTTAGCCGGAAACCTCGCTCATGCTGGAGCATCTGTTGATCTC---ACTATCTTTTCTCTTCATCTAGCAGGTATTTCATCAATTCTTGGGGCAATTAATTTTATTACCACAATTATTAATATGAAACCTCCAGCAATTTCACAGTACCAAACACCCCTCTTTGTTTGAGCGGTGCTAATTACAGCTGTACTCCTACTATTATCTCTTCCCGTCTTAGCAGCT---GGTATCACAATACTTCTAACTGACCGTAATCTTAACACTTCTTTCTTTGACCCTGCTGGAGGAGGTGACCCCATTTTATACCAACACCTATTCTGATTCTTTGGCCATCCCGAAGTTTATATTCTTATTTTACCCGGATTCGGGATAATTTCCCACATCGTAGCATACTACTCAGGTAAAAAA---GAGCCCTTCGGATACATGGGTATAGTCTGAGCTATGATGGCTATTGGCCTCCTTGGCTTTATTGTATGAGCCCATCACATGTTTACAGTTGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Boreogadus saida

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 31
Species: 69
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and abundant in arctic regions. Due to occurrence farther north than any other fish species, arctic cod may be particularly sensitive to effects of climate change and associated changes in sea ice distribution and water temperature.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: This species' preference for cold water and association with sea ice makes it vulnerable to climate change which could result in altering sea ice distribution and water temperatures in Arctic regions. A recent study in Hudson Bay has correlated decreasing July ice cover with a decline in arctic cod abundance (Gaston et al. 2003). Mortality has been associated with strong winds and storms: large numbers of arctic cod have been washed ashore during fall and winter storms in Russia; on the Kara Sea coast heaps of cod from 5 to 10m wide and 3 to 5m high, extending over tens of kilometers have accumulated after storms (Ponomarenko 1968).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: Catches are declining.; price reliability: high
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Boreogadus saida

Boreogadus saida, vertical.

Boreogadus saida, known as the polar cod[1][2][3] or as the Arctic cod,[1][4][5] is a fish of the cod family Gadidae, related to the true cod (genus Gadus). Note that there is also another fish species for which both the common names Arctic cod and polar cod are used, Arctogadus glacialis.

Boreogadus saida has a slender body, deeply forked tail, projecting mouth and a small whisker on its chin. It is plainly coloured with brownish spots and a silvery body. It grows to a length of 30 cm. This species is found further north than any other fish (beyond 84°N) with a distribution spanning the Arctic seas off northern Russia, Alaska, Canada, and Greenland.

This fish is most commonly found at the water's surface, but is also known to travel at depths greater than 900 m. The polar cod is known to frequent river mouths. It is a hardy fish that survives best at temperatures of 0–4 °C but may tolerate colder temperatures owing to the presence of antifreeze protein compounds in its blood. They group in large schools in ice-free waters.

Boreogadus saida feeds on plankton and krill. It is in turn the primary food source for narwhals, belugas, ringed seals and seabirds. They are fished commercially in Russia.

References

  1. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2006). "Boreogadus saida" in FishBase. April 2006 version.
  2. ^ Gadiform fishes of the World (Order Gadiformes) An annotated and illustrated catalogue of Cods, Hakes, Grenadiers and other gadiform fishes known to date. FAO Fisheries Synopsis No. 125, Volume 10. 1990.
  3. ^ Polar cod Institute of Marine Research, Norway
  4. ^ Arctic Cod: Boreogadus saida Arctic Ocean Diversity. Census of Marine Life.
  5. ^ Arctic Cod Aquatic species. Fisheries and Oceans Canada.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Frequently called polar cod, which is confusing when not used with scientific name. The American Fisheries Society (AFS) uses polar cod for Arctogadus glacialis, which is in the same family. Conversely, the name Arctic cod is often used in European literature for Gadus morhua, the Atlantic cod (Mecklenburg et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!