Overview

Distribution

South America: Coastal rivers in southeastern Brazil from Espírito Santo to Paraná.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coastal rivers in southeastern Brazil from Espirito Santo to Paraná, Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 65 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

5.4 cm SL (male/unsexed; (Ref. 37395))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater; pH range: 6.0 - 8.0; dH range: 2 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corydoras nattereri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTGTATCTAGTATTCGGTGCCTGAGCTGGTATAGTCGGAACCGCCTTAAGCCTACTAATTCGAGCAGAGCTAAATCAACCTGGCTCCCTTCTAGGCGACGATCAAATTTATAACGTTATCGTTACGGCGCACGCCTTCATTATAATCTTCTTTATAGTAATGCCAATTATAATTGGTGGCTTTGGAAACTGGCTTGTTCCCCTAATAATCGGAGCCCCAGATATGGCATTTCCACGAATAAACAACATAAGCTTCTGACTACTCCCACCCTCATTCCTCCTCCTTCTAGCATCCTCAGGGGTAGAGGCAGGTGCAGGAACAGGCTGAACTGTTTACCCGCCACTTGCAGGAAACCTTGCCCATGCAGGAGCCTCTGTCGATTTAACAATTTTTTCCCTCCACCTTGCAGGTGTCTCCTCCATTCTAGGGGCAATCAATTTCATCACAACAATCATTAACATAAAACCCCCTGCAATCTCACAGTATCAAACACCACTATTCGTATGGGCAGTATTAATTACCGCCGTCCTACTACTCCTGTCCCTCCCAGTCTTAGCCGCTGGAATTACTATATTACTTACGGACCGTAACCTAAATACTACTTTCTTTGACCCGGCGGGAGGAGGAGACCCAATTCTTTACCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corydoras nattereri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blue corydoras

The blue corydoras or Natterer's catfish, Corydoras nattereri, is a tropical freshwater fish belonging to the Corydoradinae sub-family of the Callichthyidae family. It originates in coastal rivers in South America, and is found in the Brazil from Espírito Santo to Paraná. It is named for Johann Natterrer, its discoverer.

The fish has clear fins with no pattern. The ventrals are light, opaque yellow. Highlights sseen about the gill plates are green. The belly is yellowish. It has a pronounced dark stripe along the length of the body. General color of the body is light, tending towards yellow. Its eyes are gold. It will grow in length up to 5.4 centimetres (2.1 inches).

It lives in a tropical climate in water with a 6.0 - 8.0 pH, a water hardness of 2 - 25 dGH, and a temperature range of 20–23 °C (68–73 °F). It feeds on worms, benthic crustaceans, insects, and plant matter. It lays eggs in dense vegetation and adults do not guard the eggs.

The blue corydoras is of commercial importance in the aquarium trade industry.

See also[edit]

References[edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2011). "Corydoras nattereri" in FishBase. December 2011 version.
  • William T. Innes (1966). Exotic Aquarium Fishes, 19th Edition. Maywood, New Jersey: Metaframe Corporation, Division of Mattel, Inc. p. 249. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!